ZFIN ID: ZDB-TSCRIPT-090929-8405
Transcript Name: crygm7-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025687 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025687|OTTDARG00000020507|ZDB-GENE-050516-8 crygm7|no_translation crygm7-003 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 623 bp
ATCATGAGTTGTTATAGTGGTGTTGACTTTATCTAATGGC
TATGTGTTTTTACCATTGCTATAGATTATCTTTTATGAAG
ATAGGAACTTCGGTGGCCGTTACCATGAGTGCATGAGTGA
CTGCGCTGACCTGCATTCCTACTTCAACCGCTGCCACTCT
ATCAGAGTGGAAAGCGGTTGCTTCATGGTCTACGACCGCA
CCAACTTTATGGGCCGTCAGTACTTTTTGAGACGTGGCGA
ATACCCTGATTACATGCGTACTATGGGAATGAATGATTGT
GTCAGATCCTGTCGGATGATTCCACTGCACCATGGGTCCT
TCAAAATGAGGCTCTACGAGCATTCAGACATGGGTGGCAG
GATGATGGAGCTCATGGATGATTGCCCCAATCTCATGGAT
CGCTTCAACATGTCCGACTTCCATTCCTGTCATGTGATGG
ATGGGCATTGGCTCGTGTATGAGCAGCCCAACTATACGGG
CAGGCAGTTCTACCTGAGGCCTGGCGAGTACAGGAGTTAC
AATGACTGGGGTGGTGTGACTTCCAGGATGGGCTCCATTA
GACGAATCACGGATCTCTAATGAAAGGAGTCCTTGTGAAA
TGTCTCCTGTATGCCCTTTTTCA

crygm7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA crygm7-201 (1)    Ensembl 796
ncRNA crygm7-002 (1)    Ensembl 598
crygm7-003 623
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
crygm7-003 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025687 (1),  Ensembl_Trans:ENSDART00000145297 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB951953 (1) 624 nt
CITATIONS (2)