ZFIN ID: ZDB-TSCRIPT-090929-8402
Transcript Name: kctd12.1-201
Previous Name: kctd12.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025684 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025684|OTTDARG00000020506|ZDB-GENE-030902-5 kctd12.1|OTTDARP00000021113 kctd12.1-001 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 1869 bp
GCCTTTGGGAAGCCCTTTGCGCACAATCGCGAGTGACTGG
CATCTTCAGCAGAGGAGACGCGATGGCTTTGGCAGACCCC
GAGTGTGGAATATCAAACGGCGCTGATTCCGCGTCTCCGT
TTTCCGTCATTATCGAACTTAACGTGGGAGGACAGGTGTA
TGTAACGCGGCACACCACTTTAATAGCCGTACCGGACTCT
CTGCTGTGGAACATGTTCAGTAAGAAAACACCGGCTGAGC
TGGCGCGGGACAGCAAAGGTCGTTTTTTTCTGGACCGGGA
CGGCTTTCTTTTCCGCTACATTTTAGACTACCTACGGGAT
CTAAACCTGGTTCTGCCGGACTATTTTCCAGAGAAAAGTA
GATTACAGAGAGAGGCTGAGTTCTTTCAGCTGCGGGACCT
TAGCAAGCTCTTGAGTCCCAAAATGAGTAAAGACAACTCC
ATCACTGACGAGATCTGCCAGAGTGACTCGGAGGAGCCGA
GCGCGAGCGCGACTCCGGTGGTCGGACCCGAGACTTCTCG
CACTCTGTCCGTCGCCAGCAGCGCACATTCTCCCTCCCTG
GAGTCCAGAAAGTCTGGGTACATCACGGTTGGTTACCGAG
GCTCGTACACAATGGGAAGAGACATACAGACAGACGCCAA
ATTCAGGCGGGTCGCGCGGATCACGGTTTGCGGGAAGACT
TCTTTGGCAAAGGAGGTGTTTGGAGACACATTGAACGAAA
GCAGAGACCCGGACCGGCCCCCAGAGAGGTACACCTCGCG
CTATTATCTGAAATATAATTTCCTCGAACAGGCGTTTGAC
AAACTGTCAGAGTTTGGCTTCCAGATGGTCGCGTGCAGCT
CCACGGGCACGTGCGCGTACTCCAGCAGCGACCCAAACGA
GGACAAAGTCTGGACAAGCTACACAGAGTATGTTTTCTGT
CGAGAATGAGCCAAAAGCGCTTTATTTAAGAGAGAGAGCG
TGTGTACATAGGCGTCCTACTACGAGAGTGAAATTTTATC
CGGTTAGGAGATGTGTATTGGAGTTTTCCTTCATTCACAC
AAAGCAAATATCTAGTTGTTTCCATAGAATTTTTAATGGC
TGACTATAGGTATTGTTAGAAATAACAAACGCAGAATAAC
TTACTATCTCAGCACTTCCATTCAGAAATTCATAATTTCA
TTTTGTTTGCAGATAAAGATTTTTGTAAGTCAGATTCAAG
GGCCTATTTGTAAAAAGATTCCCAGATGTGTTTTGTACTC
GTTATTCTTTATGCATGCATCAACAAATGCTTCATCCGAA
CACTGCATAGAGAGCAGATTTGTAAGATTTTGATGAATGC
TCTTAATGATATTTTTGTTACTGGGTGAATGATTTAAAAG
ATGATTCCACTTTAAGGAAAATCCATTTACTGAATCATTA
AGCAACCATCTGGAAAGAGTTTGACATTCATCACTGCTAG
ATCTCAATGAGGCTTTCCCCTTAAATTCTGGTTCATCTTT
TCAAATAGCTTAAACAACAAAAAATAGAACTGCTGCCTTA
ATTTTTTGTTGTAAAATATAGTGGTGCCAAAGTTACCTGC
AGTAATTCTTTGCACTTTTAGACTAATTTGCATTTCAACG
TTACAGATTAAGAAATTTGAGTTGAATATCTTAATCGTGG
AGTGGATGGAAACAATGACATTACAACTTTATTCTTTGGC
AAGGCTTAAAAGCGCTTAAACCATTTTGTATTTTGCACAC
ATTTTGCTTGGATGAAAAGTGGGAATTATTTGGTTTACCT
TTTCTTCTCTATATTGCAACAAAGTGCTCCCTTTTACTCC
AGCATTGTAAAGTGTCTCTGTTGTCTGTTCTAAGAGTTGA
TCATTCAATAAATTATAATCTGTCATAAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
kctd12.1-201 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000025684 (1),  Ensembl_Trans:ENSDART00000101977 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY120891 (1) 1890 nt
GenBank:AY394957 (1) 1875 nt
GenBank:BC056335 (1) 1864 nt
GenBank:CD605517 (1) 500 nt
CITATIONS (2)