Transcript

kctd12.1-201

ID
ZDB-TSCRIPT-090929-8402
Name
kctd12.1-201
Previous Names
  • kctd12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025684 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025684|OTTDARG00000020506|ZDB-GENE-030902-5 kctd12.1|OTTDARP00000021113 kctd12.1-001 LG_ CR536604.6 Danio rerio protein_coding KNOWN, 1869 bp
GCCTTTGGGAAGCCCTTTGCGCACAATCGCGAGTGACTGG
CATCTTCAGCAGAGGAGACGCGATGGCTTTGGCAGACCCC
GAGTGTGGAATATCAAACGGCGCTGATTCCGCGTCTCCGT
TTTCCGTCATTATCGAACTTAACGTGGGAGGACAGGTGTA
TGTAACGCGGCACACCACTTTAATAGCCGTACCGGACTCT
CTGCTGTGGAACATGTTCAGTAAGAAAACACCGGCTGAGC
TGGCGCGGGACAGCAAAGGTCGTTTTTTTCTGGACCGGGA
CGGCTTTCTTTTCCGCTACATTTTAGACTACCTACGGGAT
CTAAACCTGGTTCTGCCGGACTATTTTCCAGAGAAAAGTA
GATTACAGAGAGAGGCTGAGTTCTTTCAGCTGCGGGACCT
TAGCAAGCTCTTGAGTCCCAAAATGAGTAAAGACAACTCC
ATCACTGACGAGATCTGCCAGAGTGACTCGGAGGAGCCGA
GCGCGAGCGCGACTCCGGTGGTCGGACCCGAGACTTCTCG
CACTCTGTCCGTCGCCAGCAGCGCACATTCTCCCTCCCTG
GAGTCCAGAAAGTCTGGGTACATCACGGTTGGTTACCGAG
GCTCGTACACAATGGGAAGAGACATACAGACAGACGCCAA
ATTCAGGCGGGTCGCGCGGATCACGGTTTGCGGGAAGACT
TCTTTGGCAAAGGAGGTGTTTGGAGACACATTGAACGAAA
GCAGAGACCCGGACCGGCCCCCAGAGAGGTACACCTCGCG
CTATTATCTGAAATATAATTTCCTCGAACAGGCGTTTGAC
AAACTGTCAGAGTTTGGCTTCCAGATGGTCGCGTGCAGCT
CCACGGGCACGTGCGCGTACTCCAGCAGCGACCCAAACGA
GGACAAAGTCTGGACAAGCTACACAGAGTATGTTTTCTGT
CGAGAATGAGCCAAAAGCGCTTTATTTAAGAGAGAGAGCG
TGTGTACATAGGCGTCCTACTACGAGAGTGAAATTTTATC
CGGTTAGGAGATGTGTATTGGAGTTTTCCTTCATTCACAC
AAAGCAAATATCTAGTTGTTTCCATAGAATTTTTAATGGC
TGACTATAGGTATTGTTAGAAATAACAAACGCAGAATAAC
TTACTATCTCAGCACTTCCATTCAGAAATTCATAATTTCA
TTTTGTTTGCAGATAAAGATTTTTGTAAGTCAGATTCAAG
GGCCTATTTGTAAAAAGATTCCCAGATGTGTTTTGTACTC
GTTATTCTTTATGCATGCATCAACAAATGCTTCATCCGAA
CACTGCATAGAGAGCAGATTTGTAAGATTTTGATGAATGC
TCTTAATGATATTTTTGTTACTGGGTGAATGATTTAAAAG
ATGATTCCACTTTAAGGAAAATCCATTTACTGAATCATTA
AGCAACCATCTGGAAAGAGTTTGACATTCATCACTGCTAG
ATCTCAATGAGGCTTTCCCCTTAAATTCTGGTTCATCTTT
TCAAATAGCTTAAACAACAAAAAATAGAACTGCTGCCTTA
ATTTTTTGTTGTAAAATATAGTGGTGCCAAAGTTACCTGC
AGTAATTCTTTGCACTTTTAGACTAATTTGCATTTCAACG
TTACAGATTAAGAAATTTGAGTTGAATATCTTAATCGTGG
AGTGGATGGAAACAATGACATTACAACTTTATTCTTTGGC
AAGGCTTAAAAGCGCTTAAACCATTTTGTATTTTGCACAC
ATTTTGCTTGGATGAAAAGTGGGAATTATTTGGTTTACCT
TTTCTTCTCTATATTGCAACAAAGTGCTCCCTTTTACTCC
AGCATTGTAAAGTGTCTCTGTTGTCTGTTCTAAGAGTTGA
TCATTCAATAAATTATAATCTGTCATAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations