Transcript

ppih-204

ID
ZDB-TSCRIPT-090929-8346
Name
ppih-204
Previous Names
  • ppih-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025625 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025625|OTTDARG00000020475|ZDB-GENE-040625-127 ppih|OTTDARP00000021068 ppih-003 LG_ CR792439.12 Danio rerio protein_coding KNOWN, 897 bp
ACACATTCAAAGCAAACATTTCTGCTGTCTGAAGCGATAA
AAGCCTGAAACAGCCATGAACGTTCAGCCGTCAAATCCCA
ACAACCCCATTGTGTTCTTCGACGTCAGCATCGGAGGGCA
AGAAGTGGGCAGAATGAAGATAGAGCTTTTCGCTGACATC
GTTCCAAAGACTGCAGAAAATTTTCGGCAATTCTGCACTG
GAGAATTCAAGAAGGACGGTGTTCCTGTGGGATATAAAGG
CTGCACATTTCATCGGGTTATAAAGGACTTCATGATCCAG
GGTGGCGATTTTGTCAATGGTGACGGCACTGGCATCTGCA
GCATTTACCGGGGACCATTCGCAGATGAGAACTTCAGAAT
GAAACACTCTGGTCCAGGACTCTTGTCAATGGCCAACAGC
GGACCAGGAACAAACGGCTGTCAGTTTTTTATTACCTGCA
CAAAGTGTGACTGGTTGGATGGAAAGCATGTGGTATTTGG
AAAAGTAGTAGACGGTTTACTTGTCATGCGAAAAATTGAG
ATGTTATTTTTAATTCTCCACAAATCTCTTATGCAGAATG
TACCTACAGGACCCAACAACAAGCCGAAGCTGCCCATCGT
CGTGTCCCAGTGTGGGGAAATGTGACGTCTTTTACGATGT
GTTTAAAAAACAAACAAAAAACAGTCACTTAATTCTGATT
CTCCTCCGTCGAAAATCACATAATTTTGAAACCTATTTCA
CAGAATCATTATTATTCATGAAAATGCTTATTAGCATGAC
TCGCATTCCCATATTTACACTCATAAGCATGTGTGCGATG
TACATTCTGAAAGGCCTTTTATTTTGATCAGCTTTTTTGA
AATACAATTTGTTGTGCTTTTTTTTGTACTTGAATAAACA
TTGACCTGTTTTTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations