header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8314
Transcript Name: pla1a-202
Previous Names: pla1a-001, ottdart00000025588

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status: variant
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025588 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025588|OTTDARG00000020455|ZDB-GENE-030131-5949 pla1a|OTTDARP00000032558 RP71-68N21.1-001 LG_ BX511129.15 Danio rerio polymorphic_pseudogene none, 1371 bp
ATGGCTTGGAAATGGATCAAGGCATTTGTTTATTTGTCGG
TGTGTGTCACTTCAGCTCTGGGTGATGATGAGGAAGCGTC
TGCAAGCAAGTGTGCAGACTTCAACAACACCACCTGGCTG
GAATACAGACAGGCCACCAAGCTTCAGGTTTAGTACCTTC
TGTTGACCCGAAAGAATGCCAACTGTGCCAGTCTGTTCAC
ACAAGACTGCCTTAACCACACCCAGAAACACACTGCTTAC
TTCAACTCGTCACTGCCCACCAAAGTCATTGTTCATGGAT
ACAGGGCTCTAGGCAGTAAACCGTCCTGGGTGAGTGGTTT
AGCTCAGGCTCTACTGAGAGAAGAGGATGTGAATGTTCTG
GTGGTGGACTGGGTCTATGGAGCCTCCTTTGCTTATAACT
TGGTGGTGGAGAACTACAAGGAAGTGGCAATTCAGATATC
GGTGCTTATTAATCAGCTTACGAAATATGGAAGCACGCTG
GAATCATTTCACTTTATTGGTGTGAGTCTTGGAGCACACG
TGTCTGGATTCGTGGGGACCTTATTTCATGGCAAGCTGGG
TCGAATCACAGGTTTGGATCCAGCAGGCCCGATGTTTAAG
AGTGCTGATCCGTTTGACCGTTTGGATTCATCTGATGCCT
TATTTGTTGAGGCCATTCACACTGATTCTGACTATTTTGG
GATATCCATTCCTGTTGGGCATGTGGACTTCTTCTTAAAT
GGAGGAATGGATCAAGCTGGATGTGCTCGCTCAAGGTTTG
CATCAATGTATGGGTATGTCATTTGTGACCACATGAGGGC
TCTGCACGTCTACATGAGTGCCCTGAACGGCTCCTGTCCA
CTCATTGGTTTTCCCTGCTCCGGTTATGAGGAGTTTCTGG
CAGGAAAATGCATCACCTGTGACGACCCCTTCAATGGCAC
GTGCCCACAGATAGGCTTGTTGAAGAACAGTGGGATAACA
GCGACTCCCCTGCCAAATCAAGAGAAGGTTTATCTGCTGA
CCACTGCTTCAGGTCCATTCTGTGCACATCACATCCTTGT
GGAGTTAAACGTTTCCCGTTTAGACAAAACTGCAGAGGTT
CAGCTCATTCTGAAATCCATTGGACATCCTGAGACGGAGC
TCAATCTCAAACTATATACAGACGAAACAAGGTATAAAAC
GGTGGCTGCACACCCTGAGCAGCTGTGTAAAATTGACTCA
ATGCAGCTGATAAACACTGGAGGTCGATTCTACAGACAAG
GAGACATTCATTTTGAGTATATTTGCATCTCTGAAATCCC
TCAAACCAGAGGGATGGATCCACTATGTGTAAAGAACATT
CATATTGGACGTGGAGTACCATGGTCACATGACTTTGTAC
AGGTGTGCTAA

pla1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pla1a-002 (1) 3370
pseudogenic transcript pla1a-202 1371
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pla1a-202 Contained in:
OTHER pla1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025588 (1)
  • Ensembl_Trans:ENSDART00000171570 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)