Transcript

ppil6-201

ID
ZDB-TSCRIPT-090929-824
Name
ppil6-201
Previous Names
  • ppil6-001
  • zgc:110463-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006740 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006740|OTTDARG00000006140|ZDB-GENE-050522-70 ppil6|OTTDARP00000005999 ppil6-001 LG_ BX571790.8 Danio rerio protein_coding KNOWN, 1075 bp
GCTTTGGTAACTCTGGCAACCAGGACGCTTCGACTTTCCA
CAACATGGCATCCATTGTACATTTGGAAATCGTCGGTCTG
TTAAATAAACCTAATTTTCAAATAGCTAAAAGCATTGCGG
AGGGATTAAAAAATAAATTCCCAGATTCATTTGATGATCC
AACAATCCTACCGCTGTTGGAATGTGGCTGGCAGGACTAT
TTGTCTAATAAAAAGACGGAGCTGAGAGGAGAGGTCTGGC
AGTTCCGCGGCTGTATAATGTCCTTCGCAAACGGCCAGTT
GCTCGGGGATGAAAGGAAACTGTCCGGCTGGGCAGAGAAA
GAGTGGAAGTTTACTTTCCATCGACCACAGGCTCTTTATA
TGGCACTAGCTGAGGAGTTTTACATCAGTAACCTGCGGAG
CACTGGGCATATTTTTGTTTATATGGACATTGAGAATGGT
GGAGAGGCAGTTGGCAGACTGTTGTTTGAGCTGTTCTCAG
ACGTCTGTCCAAAGACGTGTAGGAACTTTAAGGCACTGTG
CACTGGAGAGGCTGGTTTGTCTAAAAGTAACCTTGAGTTG
AGCTATAAAGGCTCGATTTTCCACAGAGTGGTGCCAAATG
GCTGGATACAAGGTGGAGATATTTCACCTGAAAAGAAAGG
CACTGGGGGAGAGTCTATCTATGGACCAACATTTGAGGAT
GAGAATTTTGTCATATCCCACAATAAGCGTGGCATCCTGG
GAATGGCTAACCAAGGTGCTCATAGCAATGGCTCCCAGTT
CTACATCACACTACAGCCAGCCACCTGGATGGATCACAAA
TATGTGGCTTTCGGGCAACTTGTTGAAGGCACTGAGGTTC
TTAAGAGACTAGAAGCAGTGCCTACTTATAATGAGAGACC
CAAACAGGACTGCAAAATAGTAGCATGCGGCATATTTGAG
TTCTAAGTAATCACATACAGATTAAGAAGCAACATGAGAA
TTTTAAACTAACCATCTCAGATACAAATGGCTTGTCTATG
TAAAGTGTACCATGTTTTTAATCCAACGGTCCACATTTAA
AAAATAAAAATAAAGTGATTTAAAATGAAAAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations