Transcript

rbb4l-201

ID
ZDB-TSCRIPT-090929-8159
Name
rbb4l-201
Previous Names
  • rbb4l-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025415 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025415|OTTDARG00000024992|ZDB-GENE-030131-848 rbb4l|OTTDARP00000047906 rbb4l-002 LG_none CR450764.3,BX004876.7 Danio rerio protein_coding KNOWN, 1827 bp
ACCTCACGTTGGTTTTGCGCTTGTGAGATGCGCGAACTGG
TTTTGCAAGTGACGTGTGTTGAGTGTAAAAGCCTGTTTTT
CTGCTTTTTGGCTCTATATCCCTGGTCCATTCAGTGGCTA
CCCTACAGAAAAGTACGCCAAAATGGCCGATAAAGAAGTG
TACGATGACGCCGTGGAGGAGAGGGTAATAAATGAGGAGT
ACAAGATCTGGAAGAAAAACACACCATTCCTGTATGACCT
AGTCATGACACATGCGCTCGAGTGGCCAAGTTTAACAGTG
CAGTGGCTTCCTGATGTCAACAGGCCTGAGGGGAAGGACT
ATGTGGTTCACCGGCTGGTGTTGGGCACACACACTTCAGA
CGAGCAAAACCATCTGGTCATCGCCAGTGTTCAGATCCCC
AATGATGACGCTCAGTTCGACGCTTCCCACTATGACAGTG
AGAAAGGAGAGTTTGGAGGGTTTGGATCAGTTAGTGGAAA
GATTGAGATTGAGATTAAGATCAACCATGAAGGAGAAGTG
AACAGAGCCAGATACATGCCACAAAACCCCTGCATCATCG
CCACCAAGACCCCTACTTCTGATGTGCTGGTGTTTGACTA
CACCAAACACCCATCCAAACCAGACCCCAGTGGAGACTGT
AGTCCAGACCTGAGGCTGCGGGGACATCAGAAAGAGGGCT
ATGGTTTGTCCTGGAACCCCAACCTCAGTGGAAACCTGCT
CAGTGCATCTGACGACCATACGATCTGTCTGTGGGACATC
AGTGGTGCACCAAAGGAGGGCAAGATTGTTGATGCCAAGA
CCATCTTCACAGGGCACACAGCTGTGGTGGAGGATGTGTC
CTGGCACCTTCTACACGAGTCTCTGTTTGGCTCTGTGGCT
GATGACCAGAAACTAATGATCTGGGACACACGATCCAATA
ACACCTCAAAGCCCAGTCACTCTGTGGATGCTCACACAGC
CGAAGTCAACTGTCTGTCCTTCAACCCCTACAGCGAATTT
ATCTTGGCCACTGGCTCAGCAGACAAGACTGTTGCATTGT
GGGATCTGCGTAACCTTAAGCTGAAGCTTCACTCATTTGA
GTCCCATAAGGATGAAATCTTCCAGGTCCAGTGGTCTCCT
CATAACGAAACCATCCTGGCCTCCAGTGGCACTGACAGAC
GCCTCAATGTTTGGGACCTGAGTAAAATTGGAGAAGAGCA
GTCTGCAGAGGACGCAGAGGACGGGCCTCCTGAGCTGCTG
TTCATTCATGGTGGGCACACAGCTAAGATCTCTGATTTTT
CCTGGAACCCAAATGAACCCTGGGTAATCTGTTCCGTGTC
AGAGGACAACATTATGCAAGTATGGCAGATGGCTGAGAAC
ATCTACAATGATGAAGAGCCAGACACTCCTGCGTCAGAGC
TGGAGGGACAGGCGTCATAACTGATCTCATTCTAAATATA
CAACCCCTTCTTACTCTTCACATTTTGCTTTTCAGTATTA
TCCCGTAAAGTCCATTTACTCCCCATTCCATGCATTCTGA
TACTTCGTCCATGACAGGGTCCTTCTGTGGACTCTTATCT
AAAAGGTTCACCCATCATCCTTAGCAGTAGAGTAATTTGG
TTTGGATGGTATGGAAGACTGCACCACTTGTTCAATCACT
TCTGAGAAGTTACGGCCTGGTGTGGCTTATCACAAATTTC
AGTTTCTCTTTTTTTGTGTGCATAAACCTGGTGTCAATTT
GCAATAAATCTTTTGTAATAACTTTTAAAATGATTTTGTA
TTCCAAAATTGTTGATAACTGTCTGTACGCCATTTAATTC
TGAAAATAAAGTACAGATGCACTGTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations