Transcript

npepps-201

ID
ZDB-TSCRIPT-090929-8152
Name
npepps-201
Previous Names
  • npepps-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025408 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025408|OTTDARG00000020348|ZDB-GENE-060524-3 npepps|OTTDARP00000020905 npepps-001 LG_ BX469912.6 Danio rerio protein_coding KNOWN, 4426 bp
GGGCACAACGAGGACCATCTCCAGCGTTTTGTATGTTGTT
TTTCATGAGTTGTCGGGTGTCTCTGTCAGTCATACGGCTA
GCCCTACCCCGCAATCCGACTCCAATAGCGAAGCCCGTGT
CTCTGACTCTCCGAGCGAGCAGACTCCTAGTCCGTTTTAA
TTCGGTCTCCAGCGTATCGACATTATTCAGCATGCCCGAG
CGGAGGCCCTTCGTGCGGTTGCCCACTGACGTTTACCCCG
TCAACTACGGGCTGCGCCTCAAGCCCGACCTCGTCGACTT
CACCTTCGAGGGCAAACTGGAGGCAGCCGTGGAGGTTACA
CAAGGGACAAACCAGATTGTGATGAACTGTGCTGATATAG
ACATAATTACTGCATCTTTTGTGCCTGACGGGGGGGAAGA
AATTAACGCTACGGGATTTAACTATCAGAACGAGGATGAG
AAGGTGACCCTATGTTTTCCCAGCACTCTGCAAAAAGGTT
CGGGATCATTGAAAATAGACTTTGTTGGAGAGCTGAATGA
CAAAATGAAAGGCTTCTATAGGAGTAAATACTCTTCTTCG
GGTGAAGTCCGCTATGCTGCCGTCACACAGTTTGAGGCCA
CCGATGCACGTCGAGCTTTCCCTTGCTGGGATGAACCAGC
TATCAAAGCCACTTTTGACATCACCCTCATCGTCCCAAAG
GACAGAGTAGCCTTGTCGAATATGAATGTTGTTGACCGAA
AGCCATATGCAGAGGATCAGAGTCTGGTGGAGGTGAAGTT
TGCCACAACACCCATCATGTCCACCTATCTAGTGGCATTT
GTCATTGGCGAGTATGACTTTGTGGAGAGCCAGTCGTCAG
ATGGTGTGACAGTCCGTGTGTATACTCCTGTTGGAAAGGC
AGAGCAAGGGAAATTTGCACTAGAGGTTGCCACAAAGACC
CTTCCGTTCTACAAAGATTATTTCAGTGTTCCTTATCCGT
TGCCTAAAATTGATCTAATTGCTATTGCTGATTTTGCTGC
TGGTGCCATGGAAAACTGGGGCCTTGTTACTTACAGAGAG
ACAGCGCTGCTGATTGACCCAAAGAATTCGTGTGCATCGT
CCCGCCAATGGGTCGCTCTTGTAGTCGGTCATGAACTGGC
ACATCAGTGGTTCGGGAATCTAGTTACCATGGAATGGTGG
ACCCATTTATGGCTTAATGAAGGCTTTGCATCTTGGATCG
AGTACCTCTGTGTGGACCACTGTTTTCCCGAATACGACAT
CTGGACCCAGTTTGTATCTGCTGATTACACCAGGGCTCTG
GACCTGGATGCGCTAGATAACAGCCACCCTATTGAGGTTG
ATGTCGGACACCCTTCTGAAGTGGATGAAATATTCGATGC
CATATCATACAGCAAAGGGGCCTCTGTGATTCGCATGCTG
CATAACTACATTGGCGATGAGGATTTTAGAAAGGGAATGA
ATGCTTACCTTTTGAAGTTTCAGCACAAAAATGCATCTAC
TGAGGACCTATGGGAATGTTTGGAGCAAGCAAGTGGGAAG
CCTATTGCTGCAGTAATGAATTCCTGGACCAAACAAATGG
GCTTCCCTATTATTGTAGTGGATCAAGAGCAGCATGGCAG
TGACCGTGTGCTGAAAATCTCTCAGAAGAAGTTCTGTGCT
AGCGGACCACGTAATGATGAGGACTGCCCCAACTGGATGG
TTCCCATTAGCATCTGCACCAGTGAGGACCCGAGCTGCAC
TAAGACAAAGATTCTGCTGGACCAGCCTGAAACCACAGTT
AACATTACCAATGTTGCACCTGACCATTGGATCAAGATTA
ATCCAGGAACTGTGGGATTCTACAGGATTCAGTACAGCTC
CGCCATGCTGGAGAGTTTGCTGCCGGGTATCAGGGACCTC
ACACTGCTGCCTGTGGACCGTCTGGGTCTGCAGAACGACC
TCTTCTCCTTGGCTCGAGCAGGTATGATCAGTACTGTGGA
GGTGTTGAAGGTGATGGAAGCATTTGTGAATGAGCCAAAC
TACACGGTGTGGAGTGACCTGAGCTGTAATCTGGGTGTTC
TGTCCTCTCTGCTCTCACACACTGACTTCCACGAGGACAT
CCAGGAGTTCATCCGAGATCTCTTCACCCCCATCGGCATG
AAGCTAGGATGGGACAGCAGAACCGGAGAGGGTCACCTGG
ATGCCCTGTTGCGGGGTCTGGTGCTGGGGAAGCTGGGTAA
AGCGGGGCACAAGGCCACTCTGGAGGAGGCCCGGCGGAGA
TTCAGAGAGCATGTGGAGGGTAAACAGATCCTGTCTGCAG
ACCTCAGGAGTCCAGTGTATCTAACAGTTTTGAAGCACGG
AGACAGCACTACACTTGACACCATGCTGAAGCTTCATAAA
CAGGCAGACATGCAGGAGGAGAAGAACCGCATCGAGAGAG
TGCTGGGAGCCATTCCTGCCCCTGACCTCATCCAGAGGGT
TCTTAACTTTGCCCTGTCGGAGGAGGTTCGTCCTCAGGAC
ACTGTTTCTGTAATCGGGGGTGTTGCTGGGAGCAGCAAAC
AGGGCCGCAAAGCCGCGTGGAAATTTGTAAAGGACAACTG
GGAAGAACTTCACAACCGTTATCAGGGTGGCTTCCTCATA
TCAAGACTCATCAAGCTGACGGTGGATGGGTTTGCAATAG
ATAAAATGGCTGCTGAAGTTAAGAGTTTCTTTGAAAGTCA
TCATGCGCCAGCGGCCGAGCGCACGGTACAGCAGTGCTGC
GAGAACATCCTCCTGAACGCCGCCTGGCTGAAAAGAGACG
CAGACGACATCCACCAGTATCTGCTTCAGCGGAAAACACC
ACCCGTCTGACCTGAACTCTGACCTCATGACCTCCCTGAC
CTGCTCACTCACTCCAAAATGAGCATCATCCGGCTACTTT
CAGCAAAAAAATATATATATAAAAAAAACAGAAATGATTA
CAAAACTGCAGTTTCATCTTAACAAATACCCAAGAGTCTA
TCAAGAGAAGCCTAGGAAACCAGACTGCTATTCACTCCCG
AGTGTGACGTAGTTCCCCATTCTGCCAGCAGGAGGCGCCA
GATCTGTGACTGAAGCGATTCTCCATGTTATTTTTATGAG
CTGTTGATGCATGTACACACACACACACACACACACACAC
GTGTGCGTTCTCACGTCAGTATAACGCTCCTTTCACGCAG
TGGTATTATAACGCAAACGTTTCTCTTTTCCTTACATTTG
AAACAAAAAAGCATGATGTTGATATGCTCTGTTTTTAAGT
TTGTTTGTTTGTTTGTTTGTGTTTTCTTTTGCTCTGTACA
AATGACAACCTCCTCCTCCACCTGTTTTATTAGTAATGGC
TGTATAACGCATTTTACCCAGAATCTTCCGGCGGCGCAGA
TGGGCGGCAGAATGGGGGTCAAAGGTTGAGCTGCACTGGT
AACCGAACGGACTCAATGGTAACGGCTCTGAATCCCATCG
TTTAGTAACGGTTAGGACTGAAGACGCATAAGCATGGTAC
TGTGTGTATATTGTAAACCGCGAGCATTAGTTCTCAGACC
TTCAATTAATCTGAAATGTGAGTATATATACATACAACTT
CTCTCTGTTCTTCGCCCTTGTCTCCTGTACGTCACAGTCA
TCTGTTTTAACACCTCCGACAACATGGAGGATAAACATCA
TTCGCATCTGACATGGTAATACACAAAGCTCTTAGATGAA
CTTTTTATATAATATCTGTTTGATTATTATCATTTTTGAA
ATCAATAATGGCATTTAAGACTTAAAAAAGTAATCATGAT
TAAACCGGGTTTCAAATGAGGCATTAGATTTAAGATGATT
TGATAAATGATCAATGGTGTTTGTGACAAACTGAGATAAC
AGCGGGCTCACATTAAACACATCCGACTTTCTGATTTGGC
GTCAAACGCGGGATTCGTGATCATCAGATTCTGTCTCTGA
ACTTTCCCTGAAATGTGCTTTTGTTTTAAAATACAATTGA
TGTTCATTAAAGAAGATGAGAAATGAGACGGGCACAGCTG
TATTGTGGGAATGCTGTGGTGGATTTGTACGTTGTGACTC
TTCATGCTCTTATGTCTGTGTGCAGTTTTTGTACTATACA
CGGATAAACATGCATCCCTTAAATGTAGATCGCGCCCTAG
ACGTTCATACAATGTTTAAAAAACAACAACATATCAATTT
ATGAGTACAAATGTAAATAATGATTTCCAATAATGTGCAG
TAGGTACAGTCGGAGGAAAGATGGAGACTTATCCGCATTA
CAGATGCTTGGTTTTGGGACACTGAAGTGTATGATGATGA
TGATGCACAGGGTTAATTTTGGGAGCTTGTGTTCACTGAA
TGAATTTTAATAGCAGATAATAGTGTCACCGATTTCACAA
GATTTTCTTTGCATTATTGCTCAAGACTACGTGGTAACTA
GGGAATAAAGAAAGTCACTGATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations