ZFIN ID: ZDB-TSCRIPT-090929-813
Transcript Name: cyp39a1-201
Previous Names: cyp39a1-001, si:dkey-69h9.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006684 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006684|OTTDARG00000006097|ZDB-GENE-041014-339 cyp39a1|OTTDARP00000005949 cyp39a1-001 LG_ AL929058.4 Danio rerio protein_coding KNOWN, 2274 bp
ATTATATGCGTTCAAGTAGAGCGTCACTGGATCTCAGTTT
GCCATGGAATGGATTACTTTAATTCTGACGGTGTCTGTGG
TGATTATTTCGTTTCATCTTCTCTTTGGTAAAAGTCACCC
CAATGCTCCACCATGTATAAGAGGTTGGATACCCTGGTTT
GGGGCTGCTTTTGAATTTGGCAAAGCACCTTTGCATTTCA
TCCAGCAAGCCAGAGCCAAATATGGTCCAGTTTTCACAGT
GGTGGCTGCTGGGAAGAGAATGACATTTGTGACCCTAAAT
GAGGACTTCCGAGTTTTCTTCACCTCCAAAGATGTTGATT
TTGAACAAGCAGTGCAAGAACCCGTTCACAACACAGCTTC
TATCAGCAAAGACAACTTCTTTGAGTCCCATCCGACCTGT
TCGGCTATAATCAAAGGCAGACTGACTCCGGGCAACACGG
CGATGCTCTCTCCTCATCTCTGTGAAGAATTTAATGACCA
TTTGGAGAGCCTTGGAAGCGAAGGATCTGGACAGCTAAAT
GAGCTCATCAAGAGTGTGATGTATCCGTCAGTGATGAGCA
ATTTACTAGGCCGCTGTAATTCGCCCAGCAGCGCTCTCAG
CAGGCAGGAGTTCCTGGAGAAGTTTACAACCTACGATGAG
GGATTTGAGTACGGCTCACAACTCCCAGAGATGTTCCTCA
AGGAATGGTCAAACTCAAAGCATTGGCTGCTTTCTCTGCT
GAGAAAAATGGTTATCAAATCAGAGGAGACCCTCTATAGT
GAGAGTGATAGAAAGACTTTACTACAGCACCTGGCTGCTT
CAATAAGTGAACAATATCTACCCAACTATGGTTTACTGTT
GCTTTGGGCTTCCTTGGCAAATGCCATACCAGTAACATTT
TGGGCAGTTGCTTTCATTTTGTCCAATCCCACAGCATATA
AGATTGTAATGGATCAGATCAACTCTGTCCTTGGTCGCCA
AGACAAGCAGAAGACAAAGGTGACCCTAGATGACTTGCAG
CAGATGCCGTATGTGAAGTGGTGTATCATGGAAGCCATTC
GGCTGAGGGCCCCCGGAGCCATCACTCGCAAAGTAGTGCG
ACCTCTCAAATTACAGAATTACGTTATCCCACCTGGAGAC
ATGCTGATGTTGTCTCCTTACTGGGCTCACCGAAACCCCA
AGTATTTCCCAGACCCGGAAGATTTCAAACCTGAACGATG
GGAAACGGCAGATTTAGAAAAGAATGTCCTCTTGGAAGGG
TTTGTGGCATTCGGAGGGGGGAAAAATCAGTGCCCAGGAA
GGTGGTACGCCATTATGGAGTTGCATATGTTCGTGGCCCT
CATCCTCTACAAGTTTGAGTTTGCCCAATTGGATCCAATG
CCTAAGCCGAGTCCTCTGCATTTGGTGGGAACCCAGCAGC
CAGACGGACCCTGTACAGTGAGATACAAGCACAGATAGAG
CGCTCATGTTCACAGGGCTGTGCTGCTGCTTTTGAGCTTT
GCTGACAGTCCTGACATTAGAGTTGCAGAGATCAACGGCA
CATCCTGGGCTGAGCTTCAGAGGTTTGAAGCATCATGCTG
AATGTTAAACAGCAACACGGACACTCACTAAGCAAATACT
ATATACCCGTCTAAAGGAAAGCAGAAAATCATACAGATAA
TTAACGATATTCACTTTTACACGTGTCACAGTTATGTTGG
GTCATCCTCCTATATAATTAATGGCATAATAGAGATGATA
TACATCAGAAAGCCAGAGGTTGTGGAAATTCCTCTCCCGC
ACTGAGAGGCTTTATCATTTACAGGATGTATGAAGTAAAC
AGAATGTGTTGCAGTCATATATTAAACATCTTGCGCATGA
AAAGGACAAAGTAATGGCAAAGTTTATAGACAATAAAACT
AAGTGGAGGTTCTCTTTTGTGAAGCAGAAATATGTAAACA
CATTATTACATGTATAAACACTGTGCTTCTTTTCTGCGAT
GGCGAAAAGGATGGTTTCTGTAAACACATCTGTCTTGTAG
TCTTTAAGTTCTTTACGGCATCTGTGCGCACTCATTTTTG
GAGAAAACATTAGATGACATAATTTACATGGGGTGGGTTT
TTTCAAGCATCTTTAATTTGTAAGGCAAACAGAATGTTTA
CACTAATTAAAAATGAAGATACTTCATTGAATCAATCACT
GAGCTTGTGTACATTACGAGAAAAAAAGAAACCCTTTGTG
CTACTTTGCAGTGTGCTTTTCAACAAATAACAGCTTGATT
GTGTTTCAATAAAGAACATGTTTTCGGTGCAGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp39a1-201 Contained in:
OTHER cyp39a1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006684 (1)
  • Ensembl_Trans:ENSDART00000005764 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH506355 (1) 941bp
    GenBank:EB958861 (1) 519bp
    CITATIONS (2)