header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-8110
Transcript Name: atoh1a-201
Previous Name: atoh1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025362 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025362|OTTDARG00000020311|ZDB-GENE-990415-17 atoh1a|OTTDARP00000020864 atoh1a-001 LG_ AL807792.6 Danio rerio protein_coding KNOWN, 1630 bp
AGTAAAGAAATCCCCTTCACCACAGGTGTAAGAAGAGAAA
TCTTCCCAGGCAAAATATCCGTCCCTGTATCCATAGCCAC
AAACTTTCCTCCCAAAAGCACAAACCAACAGAATGGATGG
AATGAGCACGGATACAAGAGAGGTGGTTGAACTCGACGTC
CAGCATTCGAGCTTGGGGCGGGGGGAGCAGAGCGAGTACC
CACCAGCCTTGGCACTCATGGCCAGCAGTGACCCACGCGC
CTGGCTGGCTCCCGTGCAGGCTGGCACCTGCGCGGCACAC
GCCGAATACCTGCTGCACTCGCCCGGCTCGAGCGCGGAAG
GCGTGTCCTCTGCCTCCAACTTCAGGAAGAGCAGCAAGAG
TCCTGTCAAAGTACGCGAGCTCTGCCGGCTTAAAGGAGCT
GTGGGGGCAGATGAGGGCAGACAGCGGGCCCCATCCAGCA
AATCCACCAACGTCGTGCAGAAACAGAGGCGAATGGCTGC
CAATGCCCGGGAGAGGCGAAGAATGCACGGATTGAACCAC
GCGTTCGACGAGCTGCGCAGTGTCATCCCAGCCTTTGACA
ACGACAAGAAACTCTCCAAGTACGAAACCCTGCAGATGGC
CCAGATCTACATCAACGCCCTGTCCGACTTACTACAGGGC
CCCGGTGCTAAAGCCGACCCGCCAAACTGCGACCTGCTGC
ATGCCAACGTGTTAGAAACGGACCGATCTCCCAGAGGATC
ACCGGGCGTCTGTCGGAGAGGCACGGGCGTGGGTTACCCG
TACCAGTACGAGGACGGAACATTCAACTCTTTCATGGAGC
AAGACCTCCAGTCGCCCTCTGGAACGAGCAAGTCTGGTTC
GGAGGCCAGTAAAGACTCGCCTCGGTCGAACCGGAGTGAT
GGAGAGTTCTCGCCTCACTCGCACTTCAGTGACTCAGACG
AAACGCACTTGGAGCTGCAGAGTGAAGACGAGCTGTCGGA
ACTGAAACTGGCCAAGCGCCGCGCTTTTTAAGAAAACACA
CCGCCGGACTGTCCCTCAATCGTGTCAATCGCATATCTGG
GCTTTGTAATGGGTTGCTTTATTTATCCATTTGTTTTATG
ATCTTTTGACAATGCTGTTGTTGTGTCTGACGCCAATAGA
TTTTAGTTGCCTTCTCGTGACATTGACCAGACCCCTACGC
CATGAGAACTGCCGCGAGCAGCAGTGCCATGGGCTCGAAT
GTCATGCATAAAACTGTCTTCCGCAAACTGTTTTGAGACT
ATTCATTCACACATGATTGTCATGGACCTATTTCACAGAT
ACGATTGATTTTGAACCCTGTAACAATTTGCGACTTCTAA
AGTTTACTTGCACTTTAAAAAACGGGCCGTAGGCTTGAGA
AATATTCTTTTTTTCATGGAACAAGAAATGATGTGTTTAT
GTAGAAGTAATGCCAATTTGATGAATATATTTAATATAGC
CATTAGATTTTGTACATCCGTTCATTTTTAATATTTGATT
TCAATGCAAAGAAGTTGTGTTCTGCTTCTGTAGCTGAAGT
AAGCTATTTATTCGTTTGCCTTGTCAATTTTTGTGTTACA
TTGGAAATGAGCTGTTTTGTTACTCTTATGATTTGTTTTA
TTGTAGGAATAAAAGAAAAAACAAACATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atoh1a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025362 (1),  Ensembl_Trans:ENSDART00000077642 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC117598 (1) 1650 bp
GenBank:AF024536 (1) 938 bp
CITATIONS (2)