Transcript

mafk-201

ID
ZDB-TSCRIPT-090929-8004
Name
mafk-201
Previous Names
  • mafk-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025248 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025248|OTTDARG00000020250|ZDB-GENE-040624-9 mafk|OTTDARP00000020778 mafk-001 LG_ BX908797.10 Danio rerio protein_coding KNOWN, 1345 bp
AGTTCAGGGAAACATTTCGCTTCGGTTGCAGGACGCGGGA
CGAGGCTCGACCTGTTGACTCCAGGACACTTTCTCAGAGT
TTCTGCGCATCCCCGACACAGATTCCGCGTTCACAAGACA
GATTTTTGAAGAGTTCTGACTAGCTGCTTGTATGCAGGGC
ATGACGACTCATTTTAAAGCAGGCAAAGCTTTAAAGGTAA
AGAAGGAGGCAGGTGAGAATGCTCCGGCGCTCAGCGACGA
TGAGCTGGTGGCCATGTCTGTGCGGGAGCTCAACCAGCAC
CTGCGCGGCTTGACCAAGGAAGACGTGGTGCGGCTGAAAC
AGCGGCGGCGCACGCTCAAGAACCGCGGATACGCTGCCAG
CTGCCGCATCAAGCGCGTCACGCAGAAGGAGGAGCTTGAG
CGGCAAAAGACGGAGCTGCAACACGAAGTGGACAAGCTGG
CTCGAGAAAACGCCAGCATGCGACTGGAGCTGGACGCGCT
TCGAGCTAAATACGAGGCCCTACAGTGCTTTGCCCGGACT
GTCACCCGTGGGCCGCCCGGTAAAGTGGCTGCTACCAGTG
TCATCACGATTGTCAAGTCTGCCAATCACAGCCCAAGCTC
CGCCCCCTTTTCAGCACAATCGTAGTGCAGGCTGACAGTG
CCAACCTGGTCCAATCTGGCTCTGAATCCAGACTGAATCT
GAATCTGAGATGCTCGGGGTTCAGACTGACGGGATGGCGG
ACGCCTTCATCTACGCGACTACAACAGGCTGCATTCATTT
TCTTTCATGTTTTTTTTTTTTTTTTTATACTCATACACAA
AATACATTTATATTGTCTGTGCACTGTGCTAGAAAGTCCG
GCACCGGCAGGGCACGACGACCGCTATTTCCACAGGCTGA
GCGTTAGCTGAGATGAGCACTTGTTGAAGAAGATACTTGA
TTTATGATATGGCAGCACTGGTCAGACAGCTCTGTGACAT
ATTACATATGCATTGGAAATATTTTATATATCTTACGTAA
TAATTATTCCTATATATTACAAAAATATATAGTATAGCAC
TCAGATGGTTGAGGTCAGTAAGATATGATGCAATTTTGTT
ATATATAATATATTCAGCAGCAAATGTAGCTTTGTTGTCA
TTTAAATAAATTATAATTTAACGCATTCAAAGAGGAAACT
TTTTAAACTATTCCATACAGTGGCAGAGAGAGCTTAATGT
GCTGCAATTTAGGGGTGCTTTCACACCTGTAGATCGATTG
TTTTGTTCCAAAACAGGGCTTATAACCATTACTGTGTTGC
TCTTTGTTCTTGGTGTGGTTGGCTTTCACACAGCAAAGTT
TCTAAATGGACCAAAATAGCTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations