ZFIN ID: ZDB-TSCRIPT-090929-8004
Transcript Name: mafk-201
Previous Name: mafk-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025248 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025248|OTTDARG00000020250|ZDB-GENE-040624-9 mafk|OTTDARP00000020778 mafk-001 LG_ BX908797.10 Danio rerio protein_coding KNOWN, 1345 bp
AGTTCAGGGAAACATTTCGCTTCGGTTGCAGGACGCGGGA
CGAGGCTCGACCTGTTGACTCCAGGACACTTTCTCAGAGT
TTCTGCGCATCCCCGACACAGATTCCGCGTTCACAAGACA
GATTTTTGAAGAGTTCTGACTAGCTGCTTGTATGCAGGGC
ATGACGACTCATTTTAAAGCAGGCAAAGCTTTAAAGGTAA
AGAAGGAGGCAGGTGAGAATGCTCCGGCGCTCAGCGACGA
TGAGCTGGTGGCCATGTCTGTGCGGGAGCTCAACCAGCAC
CTGCGCGGCTTGACCAAGGAAGACGTGGTGCGGCTGAAAC
AGCGGCGGCGCACGCTCAAGAACCGCGGATACGCTGCCAG
CTGCCGCATCAAGCGCGTCACGCAGAAGGAGGAGCTTGAG
CGGCAAAAGACGGAGCTGCAACACGAAGTGGACAAGCTGG
CTCGAGAAAACGCCAGCATGCGACTGGAGCTGGACGCGCT
TCGAGCTAAATACGAGGCCCTACAGTGCTTTGCCCGGACT
GTCACCCGTGGGCCGCCCGGTAAAGTGGCTGCTACCAGTG
TCATCACGATTGTCAAGTCTGCCAATCACAGCCCAAGCTC
CGCCCCCTTTTCAGCACAATCGTAGTGCAGGCTGACAGTG
CCAACCTGGTCCAATCTGGCTCTGAATCCAGACTGAATCT
GAATCTGAGATGCTCGGGGTTCAGACTGACGGGATGGCGG
ACGCCTTCATCTACGCGACTACAACAGGCTGCATTCATTT
TCTTTCATGTTTTTTTTTTTTTTTTTATACTCATACACAA
AATACATTTATATTGTCTGTGCACTGTGCTAGAAAGTCCG
GCACCGGCAGGGCACGACGACCGCTATTTCCACAGGCTGA
GCGTTAGCTGAGATGAGCACTTGTTGAAGAAGATACTTGA
TTTATGATATGGCAGCACTGGTCAGACAGCTCTGTGACAT
ATTACATATGCATTGGAAATATTTTATATATCTTACGTAA
TAATTATTCCTATATATTACAAAAATATATAGTATAGCAC
TCAGATGGTTGAGGTCAGTAAGATATGATGCAATTTTGTT
ATATATAATATATTCAGCAGCAAATGTAGCTTTGTTGTCA
TTTAAATAAATTATAATTTAACGCATTCAAAGAGGAAACT
TTTTAAACTATTCCATACAGTGGCAGAGAGAGCTTAATGT
GCTGCAATTTAGGGGTGCTTTCACACCTGTAGATCGATTG
TTTTGTTCCAAAACAGGGCTTATAACCATTACTGTGTTGC
TCTTTGTTCTTGGTGTGGTTGGCTTTCACACAGCAAAGTT
TCTAAATGGACCAAAATAGCTAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mafk-201 Contained in:
OTHER mafk-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000025248 (1)
  • Ensembl_Trans:ENSDART00000167844 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC096990 (1) 1361bp
    CITATIONS (2)