Transcript

psma6a-002

ID
ZDB-TSCRIPT-090929-7897
Name
psma6a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000025131 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000025131|OTTDARG00000020185|ZDB-GENE-020326-1 psma6a|no_translation psma6a-002 LG_ BX649530.13 Danio rerio protein_coding KNOWN, 887 bp
GCTCAGTCATTTTGCTGCAGCATCATTCAGCAGCTTCTCC
TGCTCTGGATGCTGCGTTTGTGCTAGTATTTCACTTTAAT
GTGATTGAGCTAAAGAATATGCTTTCAAGGCCATTAATCA
GGGAGGTCTGACGTCAGTAGCTGTTCGAGGGAAAGACTGT
GCAGTTGTTATTACCCAAAGGAAAGTTCCTGATAAGCTTC
TGGATTCGTCCACTGTCACTCATTTATTCAGAATAACAGA
GAACATTGGCTGCGTGATGTCTGGCATGACAGCTGACAGC
AGGTCGCAGGTGCAGAGAGCGCGATATGAAGCCGCTAACT
GGAAGTACAAATATGGTTATGAGATCCCGGTGGACATGCT
GTGCAAGCGCATCGCAGACATCTCTCAGGTGTACACTCAG
AATGCAGAGATGAGGCCGCTCGGATGCTGTATGATCGTGG
TTGGTGTGGACGAGGAGCTCGGGCCGCAGGTCTACAAATG
CGATCCTGCCGGTTATTACTGCGGTTTTAAAGCCACTGCT
GCGGGAGTCAAACAAACAGAGGCCACCAGCTTTCTGGAGA
AGAAGATCAAGAAGAAACTGGACTGGACCTTTGACCAAAC
AGTGGAGACTGCCATCAGCTGCTTGTCTACAGTTCTGGCC
ATCGACTTCAAGCCATCCGAGCTGGAGATCGGCGTCGTGA
CCACAGAAGAGCCCAAGTTCAGAATTTTGTCCGAGTCTGA
GATCGACACTCATCTGATGGCTCTGACTGAACGAGATTGA
GAACTGCATGAGTGTTTATCCTGTGACAGAGAAAAACATC
TGAGAACTACAGTCTGTCAACATTCAGGTCATCTGATCAT
TTATTGCTGTTTATGTAGCTTTTTTCTTGCAACAGTACAA
TAAAATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations