header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7890
Transcript Name: mphosph10-201
Previous Name: mphosph10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025123 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025123|OTTDARG00000020181|ZDB-GENE-030131-2146 mphosph10|OTTDARP00000020683 mphosph10-001 LG_ BX663518.10 Danio rerio protein_coding KNOWN, 2248 bp
ATGTTTCCGGGGGGTTGTGTTTACCAAGCGCACGCTCAGC
GTCACCCATGTGAGTGCAGAGATGGCGACGAGGGATGGCG
GCACGCTGGAAAGCTGTTTACAGTTATTAAACAGCAACAC
GTCACACCCGGAGCTATTTCTCAGTGTCCAGGATGTTTTG
GCAACAGACTTCAGATCACTTACAAAGATTCTTTATGACC
TGCAAAAAGCCCACGAGCCTGCAGACTGTAAAGGAAGCCC
ACTGGAGCAGCTGGTGGTTGAAAACTTCGACGAGGAGCAA
ATTTGGCAGGAGCTGGAGCTTCAAAACAGCGCATTACTGA
CACACTTTGAGCAGGCAGTCGAGCAGGCGGTCACTGATGA
TGCTATAACATTTCTGAATGATGAAGATGATGATGTTGAA
GAAGACGAAGAGGAGTTGGAGGAAGTTGATGATGAGGAAA
TTGCTGATAACTTGGAGCAAGGGAGTGCAGAGGAGGAGGA
CGATGAAGATGGAGAGGAGGAAACTACACAGAGGCTGAAA
CCTACAAGCAATGGGGAAGATGACTTCTCTGGCGAAGACT
CCGATTTGGACTTTGATGTAGATAAATTTGAGAAACAAAC
CAAACAGAGACAGTCTGCTGCTGGCAAGTTAACAAAATCT
AAACCGAACTGGACTCAGTCTGAAGTGGATGACACGTTTT
TTAAACTGTCAGAAATGGAGGCTTTTCTGGATGACATGGA
TAAAAGAGAGGGAAAAGGGAATGAAGGGGAGGAAATTGAT
TACTTTCAGGATCTGCCGTCTGATGAAGACGATGAACTGA
GCTTTGATAAACCAGTCGTGAAGAAGAAACTTAAGAATAA
AAGCTCCAGAAATATGAAATACAAAGATTTCTTTGCACCT
GTGGACGGAGAGCCTGACCCCATTCCAGATGAAGAAAAAG
AGCTGGAATCGAATGATGATTATGAGGGAGAAGAACAAGA
TGATGATGAACTAGAGGAGGAATATGAAGAGGATATGAAT
GAGGAGGATTTTGATATGGAGAGGGATGATGATGATATAG
GTGACAAAGTGAGAGATGGTTCACGCAGGGTGACCTTTGA
CCTTCCTGATGACAGTGAGGGTGAAGATGTAGAAGACATT
CTAGGTGGAAAAGCAAAAGATGTGCCTAAACCTGAGTCTA
AGTCATCATTTGAAAAGCGACAGGAAAAGATGGTGAAGCA
GATTGAAGAGCTGGAAAATGCTGCGTTGTCAGAGAAGCCG
TGGCAGCTGTCAGGAGAGGTGACTGCTCAGACTCGACCAG
AGAACAGCATGCTGGAAGAGGACATAGCCTTTGATCAGGC
CTCTCGAATGGCTCCTGCAATCACTGAGGAAACTACCTTA
CAACTTGAGGATATCATCAAACAGAGAATCAAAGATCAGG
TGTGGGATGATGTGGTCAGGAAAGAGAAGCCTAAAGAAGA
GGTGTTTGAGTATAAGAAGAGACTCACTCTGGATCATGAG
AAGAGCAAACTGAGTCTGGCTGAGGTTTATGAGCAGGAGT
ATATCAAGCAGACACAGGAAAAGAAGGAAGAGGAGGAGAA
CCCAGCACATGTAGAAATCCAGAAACTCATGGACTCGCTT
TTCCTCAAACTGGATGCGCTATCAAACTTCCACTTCACTC
CAAAACCACATGTTCCTGAAGTCAAAGTGGTTTCCAACTT
GCCAACTATTACTATGGAGGAAGTGGCTCCGGTCAATGTC
AGTGATGCCACTCTGCTGGCTCCAGAGGAGATTAAGGAGA
AGAATAAGGCAGGAGACATTCTCGGGGACACAGAGAAAAC
CACTACAGATAAGAAACGAGAGAGACGGAAGAAGAAGAAA
TTGAAGCGTCTGAAGATTCACGAGCGAGAGAAGAGACAGA
AACTCAAAGAGGCTGCAAGAGGAGGAGCAGATGACGGCAA
GAAAAAGAAGAGTAAAGCTGAAGTTGAACAGACCATCAAG
AAACTGACTAAAGGAGGAAAAGCCAAAGTGCTGACGAACG
ATGGGATGGATAAGGCCTTGCGGTCTTCTCAGGCCTTCTT
CTCTCAACTACAAGACCAAGTCCGAAGTCAAGTCAAGGGC
TCAAAGGACCAGACGGGGAAGAAGAAGAAGAAACAAAAAG
AGATTTCTGTGAACAAACTCAAGCTGTAATGTTATAAACC
TGTGTCAAAAGCAATATGTACAGTTTTATGAGAAATCTAA
TGTTATGACTTGTTGTTTTTATTCAAATACACACCTCTTT
TACTGATA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mphosph10-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000025123 (1),  Ensembl_Trans:ENSDART00000004782 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC049436 (1) 2238 bp
GenBank:BM265055 (1) 619 bp
CITATIONS (2)