ZFIN ID: ZDB-TSCRIPT-090929-7889
Transcript Name: mcee-201
Previous Name: mcee-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000025122 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000025122|OTTDARG00000020180|ZDB-GENE-050522-368 mcee|OTTDARP00000020682 CH211-214O7.1-001 LG_ BX663518.10 Danio rerio protein_coding KNOWN, 1482 bp
AAAGATGGCTTCCTCTTTACTGAAGGTTGCAGTTACAGGG
CTATCGAGGTGTGCCTGGCACACTTTACCCCCAGTGAGGG
CTCTGTCTCTGACTTGTCCCGTCAGTCAAGGTGTCCCTCA
GTCATTGTGGAAGTTGGGCAGGCTGAATCACGTGGCTATC
GCAGTGCCAGACCTGGAGAAAGCCACAGCCCTGTACCGTG
ATGTGCTGGGGGCTCAAGTGAGCGACACTGTGCCTCTCCC
TGAGCATGGGGTGTACACTGTGTTTGTGGAACTGGGCAAC
ACTAAACTAGAGCTTCTGCACCCACTGGGAGAGAAAAGTC
CTATTGCAGGATTCCTGCAGAAGAACAAAGCTGGAGGGAT
GCATCATATCTGCATTGAGGTGGATGATATCAATGCAGCA
ATAGTTGATTTGAAGGAAAAGAAAATCCGCCTGCTCTCCC
CAGAGCCACGGATAGGAGCTCATGGCAAACCTGTGATGTT
CCTCCACCCTAAAGACTGTGATGGGGTACTTGTTGAGATA
GAACAGGCCTAGATAATAAACACTGATATTCCTGTCTTGC
AAACCAGTGACTTTGATTAGACTGTTGAGTTCTACAGCTT
AATGTATTAAGTGATATATGCAAAGATTTTCAGACAATTC
CAGAACCTATCATTGTAACCTGTTACGGTGTATTTGACAT
TTATGATAATTATGTATTTATTCCTAACTGATGATTTTCT
TCAATGACTTGAATAAATGGTTAATTTCATAATTTAAAAG
AGTAATTTAGTGTGTAACATTTAGAAATAATATTTGTATT
TACGCTTGGGGGGGGGGGGGGGGGTTGGGGGGGGTGCAAT
ATATGTTTTAGATAAAAAAAACCCCACTATTTACTGTCAG
AACAAAGAAACAAGCTAAATGAAATCCATTTTAATTACTA
TAAAAACAGCAGATAAACTTAGCCAAGTTTATTAATGTGA
ATTAAAATCCTAGCAAGCTTCTCATCTGACTCTCAATGGA
GTAGACAGATTGAAGCTTTCTTTTTAGTTTTTTGGCTGAC
ATCCATGTATTTGGGAGGCAAGCTGGCTCATACCCATTCC
TCCACCATAGACAGCCCTCTGCCAAATAGAAAGTTATTTT
TGTTTGTACGCCTTAAATCTTCTTTATAAAAGAGATAACT
AGAGGAGTGGTATTGGGAACTGATGTTTTGGGGCTTCTAG
TTTTGTCACTATCCTCTCAGAGGTTTTGCTTGAACATTGC
GTCTGCAGAACCGTTAGAATAATTTTCAGTTTTAAGCTGT
TTTTGACATTTTAATTTATTTGGCAGTCTGAATAGACACA
GAAATCTTTCCAGGAAAATTCACACTGAGTCTGTCACAGT
TTTTTTTAATATCTTCTCTTTTCGTCTGTGCTAGACTGCA
ACTTGGGATAGATCTGTCCATCTGTATTGCAAGCATATAT
TATTAAATCTTTAAATATTTTAAATAAAGGCATTATATTT
TA

mcee TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mcee-201 1506
mcee-202 (1)    Ensembl 909
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mcee-201 Contained in:
[BAC] CH211-214O7 (1)

Genome Resources: Vega_Trans:OTTDART00000025122 (1),  Ensembl_Trans:ENSDART00000066806 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC095773 (1) 1491 bp
GenBank:CN837330 (1) 888 bp
GenBank:EH560134 (1) 597 bp
CITATIONS (2)