ZFIN ID: ZDB-TSCRIPT-090929-7748
Transcript Name: cyb5d1-201
Previous Name: cyb5d1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024970 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024970|OTTDARG00000020082|ZDB-GENE-050417-173 cyb5d1|OTTDARP00000020563 DKEY-1C17.2-001 LG_ BX927371.12 Danio rerio protein_coding KNOWN, 1193 bp
ATGCTCGGTTACCACAGCAACCATTCACCTTGTGTGCGCG
CTTTCGAGTTCTCTTTACATAGAGTAAGTAAAACATTGCT
TTAACTCTCTCAAATAGAAGGCTTGTTAAGATGCGGCGTT
CAAAGTATTTCACACCGAGCGAGGTGTCGCTTCACAACAC
AATCAATGACATATGGGTGTCGTACCTGGGCAAAGTGTAC
GATCTCACACCACTGCTGGAGGCATACAAAGGTGATGTTT
TATTGAAGCCTATTATAGAGTGCGCAGGAAAGGACATCAG
TCACTGGTTCGACCCAAAGACAAAGGACATTCTTACACAT
GTTGACCCGTTGACTGGCTGCATTAAATACTACACCCCTA
GGGGGCGCTTCATACACATACCCCCTCCTTGCCCTCGCAC
CGACTGGGCCAATAACTTCGGGAAGCCGTGGTGGAAGGAT
AATCGCTATGAAGTTGGGCTGCTGTCTGCCAAAACACGCT
GGATCCGCATTATTAACACTCTAACCTCCCAGGAGCAGAA
GCTGGAGGTTTGCTCCGAGGAATCTTTAGATGAGATTCTC
CACCGATACCTGTTCTACAATTCCCATGCCGCAAGCTACA
CCTGGAAACACAGTGGTATAAATCTAGACATGAGTAAGAC
CCTTAGTGAAAATGGCATCCCCGAGGAGGACGAGTTTTAC
TGCGGAAGCCCAGACTGTAACCTCTTCTCTCCATCTATTT
GTCTGTACTTTAACGACGACCTCACTGAACTCTAAAGACA
CACGTTATTAAAGCGAACAACGGCGTGTAATTCATTACAA
TATCATATCCTCTGGAAGCAAATTTATGTTGCAGTCATTT
GAGCGAGAGGCATGAACGCCACATCAACTATTCATGTTTC
CAGTGTTTCATCGATTCCTGCCGGTGCTTATCTTATTGCA
GCTCTCTGGGCTTTATCCAATCAAATACTGAGCAACAGAA
TAAAGAAGATGAATGCCTGCCTACATAATAAACCCCTGAA
CCATAAAGTCTGGTGGTTGCCATGGTAATTGCTGGGAGGA
AATGCAGCAGCTACTGTATTGTAGGCCACAGCAGGCTCTC
AACCCTAATTAAGTAGCATTATATGTGTATGCATGTGCAC
GGAAATGATTTCATGCAGTCAACATTTGGGTTCAGTCGAT
GCTTTATAAAACTTATTTTTGAGATGCCGTTAA

cyb5d1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cyb5d1-201 1193
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyb5d1-201 Contained in:
[BAC] DKEY-1C17 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024970 (1),  Ensembl_Trans:ENSDART00000078421 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC093157 (1) 1231 nt
GenBank:BM957802 (1) 671 nt
CITATIONS (2)