Transcript

coq9-201

ID
ZDB-TSCRIPT-090929-7626
Name
coq9-201
Previous Names
  • coq9-001
  • si:ch211-51l3.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024838 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024838|OTTDARG00000019997|ZDB-GENE-061207-37 coq9|OTTDARP00000020466 CH211-51L3.4-001 LG_ AL929309.6 Danio rerio protein_coding NOVEL, 1387 bp
TTATTTCACAACATTTGCTAATGCTAGTCGCTGTTTTGGA
TATGGCGGCTCTGATTAGAGGACTGAGAGCTGGAAGGGCC
TTGCGGGGTCTCAGCAGCGTTGCAGTTCAAGGCACAGTCA
GTCCTCAGTGCAGCAATGTGAGACGTGGATTCCATCGAGC
CGTCCTGTTAAGACTGTCCGACAACTCTAAAAGTGACACA
TCTGTACCACCTCCATCCTACCATGAGGTTCACACAACTG
GAGATAGCTCATCATCTTCAGCACAAGGAGAAACTTCAGA
AGATGCCCAGCCAAACACTAGTTTTCAAGATCAAAGCGGT
GAACACGGTGAAGATTATGAGACAGAAGAGCAGCTTCAAG
CTCGCATCCTGACCACAGCTCTGGAGTTCGTTCCACAGCA
TGGCTGGACAGTGGAGGCCATCGCCGCTGGTGCCGAGACA
CTTGGCCTGTCAGCAGCTTCCACTGGGATGTTTAACAATG
GAGCTGGAGATCTGGTCCTACATTTTGTTGCACAGTGTAA
TACTCAGCTTGCTGAGACCCTCGCAGAGCAACATAACCAA
GTCCAGCTTGGGCACGCAGAACCAAAGAAAACAGCTGAGT
TTCTGAAGGACGCTGTGGAGATGCGACTGCGCATGTTGAC
TCCTTACATTGACACGTGGCCTCAGGCCATGAGTATCCTC
CTACTTCCACACAACATCCCTGACAGCCTGAAGCACCTCA
CCACCTTAGTGGATGATATCTGGTATTACGCCGGGGATCG
CTCCACAGATGTGAACTGGTACACGAGGCGTGCAGCGCTT
ACAGGCATCTATAACACCACAGAGCTGGTGATGGTGCAGG
ATTCATCTCCTGACTTTGAGGAAACGTGGGCCTTCCTTGA
TAATCGCATTAAGGATGTAGTTAACATTGCTAACACGGCT
AAACAGGTGCAAGCAACAGGAGAAGCTGTGGTTCAAGGAC
TCATGGGAGCTGCAATTACGCTGAAGAACCTAACCGGGAT
GAACCAGAGACGATGAGTTTTCGTCTTTCACTATCTGACC
TTTCGGCCATGCAGCACAAATGTCCGATACTTCCCTAGCC
TGCTCTAAACCAACTACACAACATGAAACGATCACAGTGA
AAGTGTGTATGTCACGATACTCCCCCAGCACTTTTTAAAT
GGGTCAGCTGTGCCATACCAAATTCCTCTGTCTGAATCTT
GACCCGAGTCCAACCAGGAGCCAGTTTTCCTTCTGCCATT
GCAGTCTCCTTCTTGTTTTCTGCATTTGTAAAAAGAAACA
AAAAAAGAAATGTAAATTGTATTTGAGAGTTCTATGTTCA
TACAGTTTGTGTCTGACTCTTTGCTGAGTCCTTCAAAAAA
GAAATAAAGGCTTACCTATTTGCTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations