Transcript

zgc:101566-201

ID
ZDB-TSCRIPT-090929-7622
Name
zgc:101566-201
Previous Names
  • zgc:101566-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024831 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024831|OTTDARG00000019993|ZDB-GENE-041010-73 zgc:101566|OTTDARP00000020459 DKEY-28J3.3-001 LG_none AL844193.7,CR382374.13 Danio rerio protein_coding KNOWN, 3935 bp
GTATTAAGCGCAATTTCCATCCTACTTTCTGCGTCTCCAT
CAATACTGAAGTGCAGAGACGCCCTTTCCAAACCACGGCT
GTATAAATAGCCTCAGTGATGAAGGGCCCAAGTACAGAGA
CTGAGGTGATTGAGGAAGCACCTGCTGACCCAAATAATGA
AGAACTTCCACCTTATCTGCGTGAAGAACCACCTGAGGAC
TTGGAAAAGGACCACCCCAAGAATGAAGCAGGCGTGGTGT
GGCGCGTGACCGGCGGTCTCTTCAACTTGACCAGAGGAGC
GGTGGGTGCCACCCTTGGTGGAGTGGCCTGGGTGGGCAGC
AAGAGCTTCGAGCTCACCAAAACAGCAGTGACGAGCGTTC
CTGCCGCCGGAGTGGGACTGGTCAAAGGGGGCGTCTCAGT
GGTAACAGGAGGAGTCGGTGCAGTGGGGTCTGCAGTGGCT
GGTAAAGTTACACCAAAGAAAAAAGACAAGTCGGATTAGA
CTGGCTGACTCACTCTCAGCTTTTGTTCCATTCGGTGTGT
CTGGGTGGTTTGTTCTCACTTTCAACAGGGTTGGAAACCA
GGCGGCAGGTTCATTTGGCCCATTTTGTCTAATTAAGTTC
ATATAAAGAACTGCAACATGGTATGTAAACTCAATTCAAC
CAATAACTGAAAGCTACTGCAGAGGTATGTGAGGGAGAAT
TGGGATCTCACCTTTGCTCTAGTTTGCTTGTATGTTTGTG
TGTGTTTTGAGTGTTATTAGACTAGATTTGGGAGAAAGAG
GGATAGCAAACATATTTTTTAAGAAGAACAGACACTTTTA
CCACAAGGAAAATGTTGATAGAGAAGCTTAGTTTAATTTA
ATGAATATGTGATCAAACATTCCACATGTAATTAAGGTAA
CTGTGTGTATCATGTACAAATGTAAGTACACTTCACAGAA
TTGCTCCACGAACATGCTGATTTAGTTTCAAGCCCATTTT
TGAACTAAATAACGGGAAAGCTCAAAAATTAAGGAAAGTA
TTGTTATTTTTTTATTATTATAAAAATAATTGCTCGAATT
TCTCACTAGATTAATAAACTAAAGTAATGTTGGTTTTAGA
CAACATACTGTCAAATGCTCTTCAATTTAGGGTGTGTTCA
CACTTTATTTGGTTCAGATGAAAAAGGATAGATTTAGTCT
TGACTAACTTAGCATTAACAGTCTGAACACAAAAACAAGC
TGTTAAAATGTTGTTTTTTTACTTCTTTTTTCTTTTATCT
CAATGTATAAAAGATTTTTTGAGAGAGAAGCAAGACCTGA
CTCTTTAGAGGTCTCAGTCCACTTGTTTGCTGTTCACATT
TGACTCAGATTAACCACACTGTGTGCTTTCACACCTGCCT
CATTTTCTGTAGGTGTTTGAATCACTAAAGTTCATTTTCT
CATTCAGGGCGATTCATTTGAGCAGGTGTGAATACATCAA
GCACACTAGAGTGTTAAACAAGTGTGGACCAGACAAGTGT
ACTGCTTGAAGAGGTGGTCCCGGTACCCTTTCAAATGAAC
ACTGGAGCAGTTAGTTTGTAGTGAAAGCATGATCCGAACT
TGAACAGTCCAGACTACAAAAAATATGGCACATTGATGGA
CTAAACCAACTGCCATAGTCAGCTGCACTGTGTATTATGG
CATGAGGTAAAGTATTTGTTTACAGTGCTGTAGCAGAAGC
TCCATGGTAGCAGACTTCTGAAGTGACTTGTGATGCGCCT
GTGAAAACTGCGTCTGAAATTGCCTACTGCATTTGAGTTT
GAATTTAATAGTATGAATGGAGCTCGTTTGTACTAGATTC
TCTGTTTTGTCATCATCATGTGACTTACCTGCGTCAGTTG
CATCACTTTTCTCTCGTTTATGAATTCTGTCCCAGTGCAT
CATGAGATAGCGTAGCTTACATTGGAAGTAGTAGGTCATC
CGGGTACTTCTCACATACTGTTTTTCGAATTCCATGAATT
CGGAAATACTACTCGGCTTACATAGAAGTATGCGATTTCG
GACGCAGCCATTGTTTTCAAGTTGCATCTGCATTTAAGTC
TTAAAATATTAGTGAGTGAAGTGCTGCATACAATCTACAT
AATATATGAAGCCCATGGATACAGTCATCATGGAGTCGTC
TATCTATTCTTTTGTCTTCTGGCTTTTCTCTTTTTTACCT
TCAGATGTTCCAGAGGAATAATCATACACAATAATTCTGA
CTAGTTGAAAAGCACTTTAGGCAATATGTAGGGATACACG
GAATTTTTGTTCGCCGCAAAAAATTGAGTTTTTGATTTTG
GAAAAGGGCTGAAAATATGAGCCAATATTCAGCGCAGTGG
TTTCACAGTCCATCCAGCCATAGTCATTGCATGGAGTGAT
GGAGTTTTCAAATCGGACATAGAAAGCGCAGCACTATGAA
TCCCATTCATTTCATTCCTCCAATGAAAAGCCCAATTTAT
TTATTTATTTATTTATTTTATTTTTTGCTGGTGTTGACTA
GAATTCAAGAGCTGCACACCTCACCAAATTTCAAAATAGC
TCAATATTCAGCTCATAAACCTATACTTATCTATGCATAA
ACCGTACATGCTCACCGGAAAAACATGGTGCACTCAAATA
ACACACTGATCAGACATTTCTACGTGGTAATTATTCCTGC
TGCTTGCAATGGCATTACTTTGATGGCTGATCAAATGAAG
CCCCTCTACTGCTCTTTTACTCAATTACATGACAAATTAT
AAAAGTCTTACAAATTTATATTATTTAAAAAAAAAAAACA
ATAAATAATAATTACAAATCAATTTGGTTTTTCTCCTAAG
TGCATCCAGAAATTTCAGTTTTGGGACAGAATTTTTATTC
TGGTGCATCCCTTGAACACATCTAGCCAGTATATTGTGTG
GATGTTGCCACATGTCGCGTTTTGGTTCATTTTAACTGCT
TCACACCCGAGCTATCAGCGTGGTGTGAAAATAAAAATGA
TGCATTATTTTTTGCCTTTGGTTCAGACCAAATGAACCGA
ACCCCAGGTGTGAGAGCACCCTAAAAAAGCACTTCCATTA
GAGTTTGTTTCAAAATAATCAAACCAGCAAAGTGTGAACA
CACTCTTACTATCAGAAACTGTAGCGATTATTTTAAAAAC
CTATTTCAGTTTATGTTTTCACAGCTAGCTCATCAAATTC
ATTTAAATCAGTCAAGGTAAGTGTAGAAATCTCTGAAACG
ACAGAAGATCACTCCAGTGTAAACATACACGACATTCAAA
ACGTACTGAATCTGCATCCAGAAAGGCAGTGGCTGGTGTA
GAGAAAAGAAATAGTTTACATGTTGAAAAGGACACATGGG
AACAGAACGCAAACCACACTGACTTAAGTTCATCAAAAAC
AAAAGGCAAGTCCACTTAATTTCTTCTCTTTGCGAAGCAT
CGTTCGTAGGTGTTTTATAACGATGCTTTATGGGCCGTAC
ATGTGCCTGAATGTTTTGGAAGTTGTAAAAGCTCACTGTG
GAGTGTTTTTAGTGTTTCAAAATAACCACAGATGTATTCC
CTGCTACCCTTTTACAGCTGTTTACATCATAGAACCAGCA
CAATTGAAAACGTGCCGATGGAGTATTTTTTTTGTCTCCT
ATTTTCCCCACACTGCTTAAATGTTTGTCTATTATTTTTA
TTTATGCAAAAAACAGCATATGGCATATTATTATATTGTT
GCAGTGCATGCTTGAAGCTCTAGTTCTCTGCTGTTAATTG
TGAGTATGTATTTCTTTCTTTCTCTTTTGTTTTTTCATGT
TTCTTTCTGTGTTTTTTTTTTGCTATCTACACACTTTCGG
TAGGTACCCATGTCTTGAAAAATCTGTTACTCTAAACTGG
ACTTTTAAGACCAAGTAGATTTTTGTCTATAATAGAACTA
TTTTTGCTAAATTTATGCTGTATTCTACAAATAAAGCATT
CTGTATTTTAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations