Transcript

ddx1-202

ID
ZDB-TSCRIPT-090929-752
Name
ddx1-202
Previous Names
  • ddx1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006524 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006524|OTTDARG00000005958|ZDB-GENE-041001-215 ddx1|OTTDARP00000005812 DKEY-161F12.1-001 LG_none BX649472.15,BX005358.16 Danio rerio protein_coding NOVEL, 2231 bp
ATGGGAGTGATGCCAGAAATTGCACAGGCGGTGGAAGAAA
TGGACTGGCTGTTGCCAACGGACATTCAGGCCGAATCCAT
TCCACTGATTCTGGGTGGAGGAGACGTGCTCATGGCTGCT
GAGACTGGAAGCGGAAAAACTGGAGCCTTCAGTATTCCAG
TCATCCAAATAGTCTATGAAACCATCAAGGACCTGCAGGA
GGGAAAAAAAGGACGCAGCGCGGTAAAGACAGGAGGAGCA
GTTTTCAGTAAATGGCAGATGAACCCCTTTGATAGAAGTA
CAGCATTTGCTATTGGATCAGATGGCTTGTGCTGTCAGAG
CAGGGAGTTCAAAGAATGGCATGGCTGTCGTACCACCAAA
GCGGTCACAAAAGGGAGGTATTATTATGAAGTTGCCTGTC
ACGATCAAGGGCTGTGCAGGGTGGGCTGGTCCACTGCCCA
GGCATCACTGGACTTGGGAACTGATAAATATGGATTTGGC
TTTGGAGGAACTGGAAAGAAATCTCACAATAAGCAGTTTG
ATAGTTATGGAGAAGAGTTCACAATGCACGACACTATCGG
ATGCTACATAGATCTGGAAAAAGGCCATGTGTCATTCTCC
AAAAATGGCAATGATCTGGGTTTGGCTTTTGAAATCCCTC
AGCAGCTGAGAAGCCAGCCGTTTTTTGCTTCCTGTGTGTT
AAAGAATGCTGAACTGAAATTCAACTTTGGCGATGAAGCT
TTCAAACACCAACCCAAAGACGGATATGTGGCCCTGAACC
AGGCTCCAGAAGGTCATGTGGTCAAATCCAGCCAGACAGG
TAGTGCTAAAGTGACTCAGGTCAAATCTAGCTCCAACGCC
CCCAGAGCTCTTATCATCGAGCCGTCTAAAGAACTGGCTG
AACAAACCCTCAATAATGTCAATCAGTTCAAGAAGTATGT
GGATAACCCTAAACTTAGAGAACTTCTGATTATTGGAGGA
GTGGCTGCCAAAGAACAGCTCAATGTTTTAGAAAGCGGGG
TTGACATTGTGGTCGGCACCCCAGGCAGACTGGATGATCT
CATATCCACAGGAAAGCTGGATCTTTCCCAAGTCCGTTTC
CTGGTGCTGGATGAGTGTGACGGGCTCCTGTCGGCCGGCA
ATACTGACTTCATCATGAGGATCTACAACCAAATCCCTCA
GGTCACCTCAGACGGCAAGAGACTACAGGTGATTGTTTGT
TCTGCTACGCTGCACTCATTTGACGTGAAGAAGCTCTCAG
AGAAGATCATGCATTTCCCCACATGGGTGGATCTGAAGGG
AGAAGATTCTGTACCAGAAACTGTCCATCATGTGGTGGTG
ACAGTCAACCCAAAAAACGACAAGCTTTGGGAGAGACTGG
GGAAGAACCACATAAGGACTGATGAAGTTCATGCAAAGGA
CGACACACGACCTGGAGCCAACAGCCCAGAGATGTGGTCT
GAGGCTATTAAGATCCTAAAGGGGGAGTACACAGTCAGAG
CCATTAAAGAGCACAAGATGGATCAGGCCATCATCTTCTG
CCGGACAAAGATCGATTGTGATAATATGGAGCAGTACTTC
ATCAAGCAAGGAGGAGGACCAGATAAGAAAGGACACCAGT
TCTCTTGTGTATGCCTTCATGGCGACAGAAAACCAAATGA
ACGCAAGTATAATTTGGAGCGATTCAAGAAACAGGAGGTG
AAATTTCTGATTTGCACAGATGTGGCTGCTAGAGGAATTG
ATGTCCGTGGTGTTCCTTATGTGATAAATGTAACTCTACC
AGATGAGAAGGAGAACTATGTTCATCGCATTGGAAGAGTT
GGCCGAGCAGACAGGATGGGTTTGGCCATATCACTGGTTG
CAATGGAGAAAGAGAAGGTGTGGTACCATGTTTGTGCCAG
CAGAGGAAAAGGCTGCTATAACACCAGACTCAAAGAGAAT
GGAGGCTGCACTATTTGGTACAATGAAAAAGAGTTGTTGT
CAGATATCGAGGAGCATCTGAAATGCACTATTACTCAGTG
TGAACCTGACATTAAAGTACCTGTGGATGAATTTGATGGT
AAAGTGACGTACGGCCAGCGCAGGGCCACAGGAGGTGGTC
TTTACAAGGGCCATGTGGATATTTTGGCCCCGACCGTACA
GGAACTGGCCAACCTGGAGAGAGAGGCTCAAACTTCCTTC
CTTCATCTGGGTTATCTACCCAACCAGCTCTTTAAAGCCT
TCTAAAACAGCAATTGCACATGTCATGCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations