Transcript

erp44-201

ID
ZDB-TSCRIPT-090929-7452
Name
erp44-201
Previous Names
  • erp44-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024631 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024631|OTTDARG00000019892|ZDB-GENE-040426-1902 erp44|OTTDARP00000020323 txndc4-001 LG_ CR848817.8 Danio rerio protein_coding KNOWN, 2083 bp
CTGTTTCCTGCAGCAGAGGAGAAGGAGGTGGTGTCGAGAG
ACTGGCAAGATTCAACAACATCGCAACCTCAACCAACACC
ACTATACAATGAAATTATCATCAATAATACCCGTTCCCGA
ACTGCACTACTTCACCCTCCTGCTGGTAACGGGTCTGTAT
AATCCAGGACGAGGGGAAATAACCAGTCTGGACTCTGGAA
ACATCGATGACATCCTCAACGGAGCAGGTGTGGCTCTAGT
CAACTTCTATGCAGACTGGTGTCGTTTTAGTCAGATGCTG
CACCCCATCTTTGAGGAGGCGTCAAATATAGTGCGCGAGG
AATATCCAGACGCTACCCAGGTGGTGTTCGGCCGGGTCGA
CTGTGACCAACACTCTGATCTAGCGCAGCGCTACAGGATA
AGCAAATACCCCACACTGAAGCTGTTCAGGAATGGCATGA
TGATGAAGCGAGAGTACAGAGGTCAAAGGTCAGTGACCGC
CATCGCCGACTTCATCCGCCAGCAGAAAGTGGATCCAATT
AAAGAGATCGAAAATCTGGAGGAAATCAGCACTGTAGATA
GGAGCAGACGCACCATCATTGGTTACTTTGAAAAAAGGGA
CTCGGACAATTACCGTACTTATGAGAAAGTGGCCAACATT
CTGAGAGACGACTGTGCTTTCCTGGCAGCTTTTGGGGAGG
TTTCTAAGCCCGAACGTTTTAGTGGTGATAACATTATTTA
TAAACCATTGGGAGAAAATGCTCCTGACATGGTCTACATG
GGCTCGCTTACAAATTTTGACCTCAGTTACGCCTGGACGC
AAGACAAGTGTGTACCGCTAGTCCGAGAAATCACATTTGA
AAACGGAGAGGAACTGACAGAGGAGGGAATCCCGTTCCTG
ATCCTCTTCCATCAGAAGGATGACACAGAGAGTTTGGAGA
AATTTCAGCAAGAAGTGGCTCGTCAGCTTATTAGTGAAAA
GGGTTCTATAAATTTCCTTCATGCTGATTGCGATAAGTTC
CGGCACCCTCTACTTCACATTCAGAAGACACCTGCCGATT
GCCCTGTAATCGCCATCGATAGTTTCCGCCACATGTATGT
CTTCCCAGAGTTCAGCGACCTTGCGGTTCCAGGAAAGCTG
AGGCAGTTTGTATTGGACCTGCACTCAGGAAAGTTGCACA
GAGAGTTTCATCACGGCCCAGACCCCACAGACAGCACTCC
AGGACAGCAAGAGGAGAACAGAGAGGTGCCCAGTAATCCC
CCAGAGAGCTCCTTCCAGAAATTGGCCCCCAGTGAGACAC
GCTACACCATCCTCAGGGACCGAGACGAGCTGTGATGTCA
CATTCGCCATCGAGACCCAACCCAGAACCCAGCAGTCTGT
CGGTGCCAGTCTGGCACTGATGCTGCCTGCGCAACGTCTA
TTTTCATAATTTTATTTTAGATATTAAAAAAAGAAGGTGA
ACCCCTGAGCTTTTTTTGGGGTGGGGAATGAAGAGGAGCG
TTTTTACTTTTGTTTCTGGAGCTTGTAAATATGTTTGTGC
TCTGTGGGTCTTGTCTAAATTAAAAGTATGATTTTTTTTT
TTCGCCCTTTTTTTTATTTTGCCCTACATTTTTGTCAGCC
CGAGTCCCTTTTTTGTAGGAAAAAATTGGTACATTGGTGG
TCCTCCTTGTTGGGAACGCACATAGAGTTTATCTTGGATC
TTGAGAGTTCGGCCAAGTGGAATCATGGGAAAAAGTGTAG
TCTAAGAACAAACCTGCAGTCAACCTGTGCTGTTTCACTC
CAGTCCTCAACTGTGTGTGTGTGTGTGTTTGTGTGTGTGC
GTGAATGAGCGTGTGTGTGTTTGTGTCTGCGCACATGTAT
GTTACATGTGCTTATTAGTCTGTATTTGTATGTACTGTAC
TGGTCCAGACTTGTTTAAATTCACACTCGCTAAGATCCAG
ACTCGCTAGTCTCATATCATCCCATTCCAGCAGGGGGAGT
GGTCAGGGGGGCGGGGTTATCTGGGGGTCCGGTTCAGAGG
GATGGGGGATTATTTGTAAATCTGTCATCTCAGATGGGGA
CGAGGAAAGGAAAAGTAAATTAAAAACATTTTACAAGATT
CTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations