Transcript

mtpn-201

ID
ZDB-TSCRIPT-090929-7451
Name
mtpn-201
Previous Names
  • mtpn-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024629 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024629|OTTDARG00000019890|ZDB-GENE-040426-2166 mtpn|OTTDARP00000020321 mtpn-001 LG_ CR548631.18 Danio rerio protein_coding KNOWN, 1699 bp
TCTGAAGTGTCTTTGGGCGCTAGTTTGATAGCGGAAGTTC
GTGCCGCTGGTGGCTGCAGTTCAGGCGGATCCCGTCAGTG
TCTGATCACAAACTTTCTGTCAAACCCGAAAAACACACAG
AACCCGGTGACATGGGGGATAAGGAGTTGATGTGGGCCCT
GAAAAACGGAGATCTGGATGAAGTGAAGAATATTCTGGTT
AAGGCTGAGGATGTGAACAGGACTCTGGAAGGGGGCCGAA
AGCCGCTACATTACGCAGCCGACTGCGGTCAGGCCGAGAT
GCTGGAGTTCCTGCTGTCCAAAGGAGCCGACGTCAACGCT
CCAGATAAACATGGCATCACTCCGCTGCTGTCGGCCACAT
ATGAGGGTCACGTCACCTGCGTCAAGATCCTTCTGGAGAA
GGGCGCCGATAAGAACCGGAAAGGTCCGGATGGTTTGAGT
GCGTTCGAGGCGGCTGAAAGCGAAGCCATCAAAGCTCTAC
TAGAGTGAGCAGACGCTGCCGGCAGCGGAGAGGTTCTGAC
CACTGGATCCAGCAAACACACACTCACATACACACACACA
CACACACCTCTCTGTATCTGCCCGCTGGCTGCATCAGATC
CTCTAGGTTTCCTTTTGTTTGTTCTCCTCCATTTTTTTAT
TTTATTTTAGGGGAGGTGCTTAATTTCCCCTCTAGTTTAT
AAGAGTCAGTCATTGGCTGATGGACCTGTCACTCATGCCT
ACGGACCAATGGGAACGCCTGTCTAACACCACTAACAAAA
AACATGGACTTTAGAGTTCAGACTACAGCGCAGATTCTGT
GAGCGAGTGTATGATGATGATGATGATGTGTGTGTGTTGT
TTTTCAGACTGTTAAAGGTGCAAATGCAATTAGACGTCGG
AAAAAAAAAAAAAGAAACTCTAGCTGATGAATTTCCCTAC
ACTCCGCTTCCCTCCTCCAGCGCTCCGACATTACCGTCAC
ATTGTAGATGCTCAAAGAACAAATATTAGACTTCAGACGC
TCGAGTCGTTCTGCTGACGCACACACTCGCTTCTCCGCCC
CTTTGAATTTGTGTTGTTGTGGCAAAAATAAATGAATTGT
CAGCTGCTGTGCGCTTGTAGAGTGTTAAACAGGTGTGCTC
GGACGGGGGGGACGCCAGTTCTCTCTCTCCTTCTCTCTCT
CTCTCTTTATCTCTCTCTCTCTCTCTTGCTCAATTCAATT
CAAACTTGTTTAATTGGCATTATAAATGTTACAAATGCAT
TTCTAAAGCATTTCTAATGTTTACATTAAATAAAAGCAAA
TTGCATAGCAGTAGTGACAGCTTAATAATAAACAATGCAT
TAATAGTAAGCAGTTGGTTCTCTCAAAAACAGCTTTCTCC
TACTCAATTCTATTCAAACTTGCTTAATTGGCATGACAGA
TGCTTGTTTCAAAGCATTTGTAATGTTTAAAATAAATAGT
ACCTATGAAAACTAATGACAAAACAGTAGTGATGAAGAAA
TAATAATGAAAATACAGTAATAATAAACAGTTGGATCCCC
CCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGCAT
GATGGTGTTTAAGCTTTTCAGTTCAGTCGATTTGCTCCGA
CCTGCAGATGAACATTTTAAACATCCATATCCGGCATTGT
TGTGGAAATAATAAGTCCGTTTGAAAACAACAAATCAAAT
AAAACAGTTTCAAATTGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations