ZFIN ID: ZDB-TSCRIPT-090929-7436
Transcript Name: jade3-002
Previous Name: phf16-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024613 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024613|OTTDARG00000019879|ZDB-GENE-030131-928 jade3|no_translation phf16-002 LG_none BX323016.9,BX322552.6 Danio rerio protein_coding KNOWN, 601 bp
GTCGTCCAAGTTACCGGTTAAAACCTGATGAGGCAAATCT
GGCAATGAGATCTTAAAATGTATGGAAAAAGTCTTAAAAT
GTCTTAAAAGGTGTTGAATTTAACTCCATGATCCTTGTAT
AAAGGTCCCTCGACGTCCTTTTCCTCTAACAAGTATGGAA
GCAAACCAGGCACCCCCGCCTCTGCTCAGAAGAAACCAGC
AGAGGTGTTCAGAAAAGACCTGATCAGTGCGATGAAGCTG
CCAGACTCTCACCATATTTCTTCAGAGGATTATTACCTGT
TGGCAGACACATGGAAGCAGGAATGGGAGAAAGGAGTGCA
AGTGCTGGCCAGTCCAGACACTATCCCTCAGCCCTCTGTG
AGGTATGTCACTTTGAGTATAAACTGGGGGGAAGAAAAGT
ATTGGACGTGCACGCTCTTGCATATGGTTTAAGGGGGTCT
GGTTATGTTTTTATTCTTTCAGCTTTGCAGTTTTTGCATG
AAAGAGATCTTCAACAAAACCTGAATTGAACTGAAATGCA
TTGAACTCAACGAACAAGCCAGTATTGTGCGGTGAACCAG
TCCATGTAAATATAAAATGAGCTTAAATTAACTATTTCTA
A

jade3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA jade3-002 601
mRNA jade3-203 (1) 3243
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jade3-002 Contained in:
OTHER jade3-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024613 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT679380 (1) 585bp
    CITATIONS (1)