ZFIN ID: ZDB-TSCRIPT-090929-7420
Transcript Name: tubgcp5-202
Previous Name: tubgcp5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024596 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024596|OTTDARG00000019868|ZDB-GENE-050522-344 tubgcp5|OTTDARP00000020291 tubgcp5-001 LG_ BX322552.6 Danio rerio protein_coding KNOWN, 3831 bp
CAATGCACCGCAGAAGAAGAGTCTGAAGTCATGGAGGCGG
CAACGGGGGAAATCGTAAAACATCTAATGCTCGTACTAAA
ATATTAAGATTGAAATTCAGTCCTCAATTTGTCCTTCGTA
TTATGTTCGTGAGATAGACGACAAATTTTTTGCTTTATCT
GTAACATGTAGCATACGTCGTTGTGATGGGTTTCTTGTTT
TGCTAACCGAAGCTGTTGACAACGACTCGCCCCTGTCAGC
ATCACAACTAGAAAGCAGGTAGTCTTAACTGATCAGAATG
GCTCACTGGAGTAGGTTCGAAAAGGAGCTTGAGCTCGAGA
CCAAGAGACTCATCTCACATTTCACAGCCATTCAGGATGA
GGAAGATCAAAACTTTCAAATGGCACTGAAGTTTACCTGG
TCTAATTTTAAGTTTCATCGTTTCCTTGAAGCAAACAGAC
ATAATGTGCAGCGCTCCATTAATGGTATTCATGAGAAACT
CATGGTTCACTCTGACTTGAGTAAAGCGGAGAGTTGGACA
CGACTCACTGAAGAGTTTCTCACTTCGCCTCTTCCTAATA
CTGATGGAACAAAGACCGACATCCATTATGGCATCCTGGC
TTTGTTACTTCACCTGTCTGACTCTCCATCCAATACAAAC
TACTGTGAAAGACCCAGACTGAAAGAGACAGAGAAAGAAG
ACACGTTTGACTGGGCCAAGTACCTCATGGAAGGAGAAGA
TTTTGATCCTGGACCTTTTCCAGACACTCCAGAGTGGTCT
GAGGAGGAAAGCGAAGAAGACGACAGCCAGCAGCCCTTGA
GCAGAGAGGATTCTGGGATACAGGTGGACAGAACGCCGCA
GGAGGACCACGAGCAGAACGACAAGACCGTTCAAGTCACC
TGGACCGTTGGTGAGCCGGACTCCAGGGCTTGGTTGGAGC
AGCATATTGTCACTTCTTATTGGGTTCCCAACTCTCCCCG
TTTTCCACACAGTCTTCACCTGCACTCCAACCTCTACAAC
GTTTGGGATCAGCACTTGTATAACACTGGGCCTCTCTACC
TGCCTGAGGAGAAATCTTTTGTTACTGAGACACAAGTAAT
TCGAGAAACTCTTTGGCTTTTCTCTGGCGTGAAGAAACTT
TTCATTTTCCAGCACAATGACGGCAAGGTGACTGTAAGGA
ATGATGTGGTGGTCACGCATCTAACGAATAACTGTCTTCA
CTCTGTACTGGAGCACATAGCGGCCTATGGGCAGGCTGTT
TCCCGCCTGCAAAAGTTTATTGATGAAGTGACAGGCCACA
GCGCAGAACCCTGTCCTCCAGGTCTCAATTCTTCCTCGTC
ATCCTCCAAGAAGAGTTCCGAGCCTCCTTTTAGGACCTAC
CAAGCATTTGTTTGGGCCCTTTATAAATACTTCACCAGCT
TTAAAGAAGAGCTCAATGCTATCGAGAAAGACATCATTGC
CAAAGATGAGACTGTGACTCTGTCTTCTGTGCTGGAACGG
TTGAGTCCTCATCTGGCTCAGATCACAATGCTCCACAGGG
TTTTCTGCACAGGAGTGGCTGAGGTGCCGCCCGGAACGCC
CAATGTTTTACGAGCCTCGCACTTACTCAACACCCTCTAC
AAGGCCATCATTGAGTATGACAGTGTGGGTGAAGCCTCTG
AGCAGTCTGTGGCACTTCTTTTCTCTCTCTGGGTAGAAAC
GGTGAGGCCATATCTTGAGATTGTTGATGAATGGATTGTT
CATGGTCACTTATTTGACCCTGCCAAGGAGTTCATCATTC
AGAGAAACAAGGATGTACCGGTAAACCACAGGGACTTCTG
GTATGCCACTTACACTCTGTATAGCGTGTCTGAAATGGTG
GAGAGTGAGGAGAGGCTCAGCGATGCAGCCAGTGGAAGCT
CAGGTGGAGAACAGACATCCAGCAGCAGACAACACACCAT
GGTGTCCTTCCTCAAGCCAGTGCTCAAGCAGATCATCATG
GCTGGAAAATCCATGCAGCTCCTCAAGAACCTGGACTGCA
AGGAGACTGAACAATCTGATGGCTCCTCTAGAGATGCTGA
GAGAAAAAGTCTGTACACGCTCTTCTTGGAGTCGGTGCAG
ACTCGTCTTCGGCGTGGAGAAGAGTCACCCACAAATACAG
TTACCGAGCAACAGGCCACTAAGAAGAGCCTGATCAAAAT
GCAGTCCATCGTGGCACGTCATCTGGAGCTGGATGACATC
CATGACCCCCTGCTGGCCATTAATTTTGCAAGGCTTTATT
TAGAGCAGAATGACTTTCATGAGAAATTCTCTGGTGGCAG
TGTGATTCTGGATCGCTCCTCTGAGTCTGTGACATGCCAG
ACGTTTGAGCTCACACTTCGCTCCTGTCTGTATCCACATA
TTGAGAGGAGATACGTTGAATGCTGTGGGAACCTCATGAG
AACCCTGAAGAAAGACTACAGGCTACTGGGGTACTTGCAG
GCCATGAGAAACTACTTCCTGCTGGAGGCTGGGGATACCA
TGTATGATTTCTACACAGCCATTTTCGACAAAGTTCTGGA
GAAGGAGAGCTGGCAGCAGCTGGCGTTCCTCAACGTGCAG
CTTCAGGAGTCTGTCGGACAGCGCCATCCTGAGGACAGTC
ATCGGTTGTCCATCTTTCTTGAAACTATCGATCCTGCGAG
GAAAAAGCAGCCAGTGAATAACCTTGATGGTCTTACGCTG
AGTTATAAGGTTCCATGGCCTGTGGATATTGTCATTAGTT
CAGAGTGTCAGAAAATCTACAATCAAGTCTTCCTGTTGCT
ACTTCAGATCAAATGGGCCAAGTATAGTCTGGACACATTA
CGATTTAGTGATTTGACAGTAGCTGCTAAGAGGAAAGAAG
GAGGCCAGCCTGAGGAAAACACAGCCAAAGAGTCCATAAA
CCAGCAGATTCACAGGATGTTTCTCCTGAGGGTCAAACTC
ATGCACTTTGTCAACAGCCTGCACAATTACATTATGACAA
GGATATTGCATAGTACGGGTCTAGAGTTTCAACACCAAGT
ACAGGAGGCAAAAGACCTGGACCAGCTCATTAAAATCCAC
TACAGATACTTGTCCACCATTCATGACCGATGTCTGCTCA
GAGAGAAAGTCAGTTTTGTCAAGGAGGCCATCATGAAAGT
GCTGAATTTAGTTCTCATCTTCTCTGACAGATGGCAGGCT
GGTTTTGGGGCCTGGAAAATCGAGTCGATTGACAAAATGG
AGTCGGATTTTAAAAACTGTCACATGTTTCTGGTGACCAT
ATTAAACAAGGCTGTTTGCAGAGGCTCATTTCCTCATCTG
GAGTCCTTGGCGATGTCACTAATGGCTGGATTTGAACAGT
GTTAACCGATCGAACATGCTGTCAATCCAGAGCAGCGAAC
ACAAGACAGATTATTTATTGTACTGCTGCATGAAGGCTAC
TGTACTGTTTCTCTTCATTTCTGCCAGACGTCTGACGCAA
AATCACAATAGCACTCCACTGGTACAGAAGTAGCACTTTG
TTTGTGTGAACAGTGAATCTTGTGTTTCGTCGTCTACTTT
GTCTATAAAACAGTTGCTGCATCAAGATACTCAGTGTTAC
AGGTGAAAGTGTCAGATGTGAATATTAAGTGTCCTGTACG
TGTAGCGGATATATGAAGCGCACATGCCAGTAATCCCAAT
TATGTATATAACATGCAATAGGCACGCTCGAATTTAAGTA
GTGTACATAACATAAGCTAAAATCCAAAATTGTAGACTAC
ATTTGTATGCAGTTCAAGCTTATATTTATATATGTTGTGG
TTGCGTAAAGTCATTTTTCATTGTGATGAATGGGCTACTG
CATATTAAAATAATTTTCATGACTTTAATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tubgcp5-202 Contained in:
OTHER tubgcp5-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024596 (1)
  • Ensembl_Trans:ENSDART00000144812 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095202 (1) 3831bp
    GenBank:CN842324 (1) 830bp
    GenBank:CF347983 (1) 794bp
    GenBank:BQ263445 (1) 656bp
    GenBank:AW154577 (1) 623bp
    GenBank:BM889952 (1) 623bp
    GenBank:AI878132 (1) 588bp
    GenBank:AL925670 (1) 533bp
    GenBank:CD604576 (1) 500bp
    GenBank:AW165388 (1) 495bp
    GenBank:AA495425 (1) 385bp
    GenBank:AA495118 (1) 281bp
    CITATIONS (2)