ZFIN ID: ZDB-TSCRIPT-090929-7416
Transcript Name: klhl18-201
Previous Name: klhl18-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024592 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024592|OTTDARG00000019866|ZDB-GENE-030131-5785 klhl18|OTTDARP00000020288 klhl18-001 LG_ BX323559.11 Danio rerio protein_coding KNOWN, 2122 bp
CACCGCCGGTGGAGGGCACTCAGTTATAATAATACAGCTC
GAGCTACGGCGTCTCGATTTGGACAAAAAGTGTCGTTTCC
AGTCCATCAATGACGATGGGTGACACGATATTTGAAGAAT
TAGAAGATTTGATGCATTTTTCTGTCGCCGATTTGCCCGC
TCGTGGATATGCAGTGATGGAGGAGATCCGACGGCAAGGG
AAACTGTGTGACGTTACGCTAAAAGTAGGAGAGCACAAGT
TCAGTGCTCACAGAATAGTCCTCGCTGCTTCTATTCCGTA
TTTCCATGCCATGTTCACCAACGATATGGTGGAGTGCAAA
CAGGATGAGATCGTCATGCAGGGCATGGATCCCAGTGCAC
TTGAGGCCCTTATAAACTTTGCCTACAACGGACACATAGC
CATAGACCAACAGAACGTCCAGGCCCTCCTGATAGGAGCC
AGTTTCTTGCAGCTTCAAAACGTCAAAGATGCCTGCTGCT
CTTTTCTACAACAGAGGTTGCATCCCAAGAATTGTCTCGG
TGTGCGGCAGTTTGCTGAGACTATGATGTGTACCACACTA
TACGATGCAGCCAACAGCTTCGTTCACCAGCACTTTGTGG
AGGTGTCTGTGTCTGAGGAGTTTCTGGCCCTTCGGCCGGA
GGAGGTGCTTGAGCTGGTGGGCTGCGACGAGCTCAACGTC
CAAGCAGAAGAGCAGGTGTTTGAGGCAGTGTTGGCTTGGG
TGCGACACGAACGTGATGATCGGGAGTCACGTTTACCGGA
ATTACTGTCTAAAATCAGACTACCTTTATGTCGGCCTCAG
TTTCTGGCAGACCGAGTCCAGCAGGACGAGCTTGTACGCT
GCTGCCACAAATGCAGGGATCTTGTCGATGAGGCGAAAGA
TTACCATTTGATGCCGGAGCGACGGCCACATCTTCCAGCT
TATAAGACCCGACAGAGATGTTGCACATCCATCGCTGGTT
TAATCTATGCAGTTGGGGGTCTCAACAGTGCTGGTGACTC
GTTGAATGTTGTGGAGGTGTTTGATCCTATTGGAAACTGC
TGGGAGCGATGCCAGCCAATGAGCACAGCGCGCAGTCGTG
TGGGCGTCGCAGTTGTGAATGGGCTACTTTATGCCATTGG
TGGTTATGATGGTCAGTCGCGGCTGAGAACTGTGGAGGTT
TACAACCCAGACACTGACACGTGGACTAAAGTCGCTAGCA
TGAACACTCAACGCAGTGCAATGGGAACTGTTGTAGTTGA
TGGCCATATATACGTCTGTGGTGGATACGATGGCAAATCC
TCTCTGAATTCAGTTGAGTGCTATGCTCCAGAGACGGACA
GATGGACGATAGTCACAGAAATGAGCGCAAGCCGCAGTGC
TGCCGGTGTCACTGTATTTGAAGGCAGAATATATGTTTCA
GGTGGTCATGATGGTCTTCAGATCTTCAACACGATGGAGT
ACTACAACCAGCATACAGCATCATGGCACCCTGTTGCTCC
CATGATAAACAAGCGCTGTCGGCACGGCGCTGCAGCTCTG
GGCAGCAACCTGTATGTAGCAGGAGGATATGACGGCTCTG
CATTTCTCAGTGGAGCAGAAGTTTACAGCTCTGTAGCGGA
TCAGTGGAGCCACCTAGTGGCCATGAACACTCGCCGCAGC
CGCATTTCTCTAGTGGCCAACTGCGGTCGACTCTACGCAG
TGGGAGGTTATGACGGACAGTCCAATCTTAGCTCTTTGGA
AATGTACGACCAGGAAACCAACCGCTGGACGTTTATGGCA
CCGATGGTTTGCCATGAAGGTGGGGTCGGGGTAGGTTGTA
TACCCTTACAGCCCGCCTAATGCCACAGTCTCCCTCAGCC
TAAATGGACATTTTGATTATTATATATTAAAGAAAAAAAA
AGGTTTTTGTACTGAGTGATCCAACAACCTGCATTCATGG
TTCTTGGTTCTCATGTTTGCATCAGAGGTACTAATCATCA
GGTTTTTGTACTGGGAAAAGCCTGAAGCAGATATGCCAGT
ACACCTTTAATGGTGACATAATCATGTTTGTTTGTTTTTT
AATGACGACCAAATGTAGAATTCATTCATACATAAAAAGA
TTGAGAAGAACCAGGACACACTTTTGATAAAAAAAAAAAA
AA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
klhl18-201 Contained in:
[BAC] DKEYP-73D8 (1)

Genome Resources: Vega_Trans:OTTDART00000024592 (1),  Ensembl_Trans:ENSDART00000022909 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC071523 (1) 2081 nt
GenBank:BC045319 (1) 1880 nt
CITATIONS (2)