ZFIN ID: ZDB-TSCRIPT-090929-7398
Transcript Name: mchr1b-201
Previous Name: mchr1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024568 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024568|OTTDARG00000019851|ZDB-GENE-030502-5 mchr1b|OTTDARP00000020270 mchr1b-001 LG_ BX465842.5 Danio rerio protein_coding KNOWN, 1056 bp
GTCCTCATGCCAAGCATTTATGGAGTCATCTGCTTCGTGG
GCATTATAGGCAACTGCATCGTCATCTACACTATCGTCAA
AAAGACAAAGTTCAGAGCCCAACAAACTGTGCCCGACATC
TTCATCTTCAGCCTGTCCATTGCTGATCTTCTGTTCCTCC
TGGGCATGCCGTTCCTCATTCACCAGCTAGTAGGCAACGG
CTCCTGGTGTTTTGGTGCCACCATGTGCACTGTTATCACA
GCGCTGGACTCTAACAGCCAGATCGTGAGCACTTATATAT
TAACAGTCATGACTTTGGACCGATACTTGGCGACAGTCCA
TCCCATCCGCTTTAATCACATTCGCACTCCCCGTGTAGCC
GTGGCAGTAGTAGCGCTGGTGTGGATCCTCTCACTGCTCT
CCATCACCCCAGTGTGGATGTATGCGGGTCTCATGCCCTT
ACGGGATGGATCAATGGGATGCGCTCTGCTTCTTCCCAAT
CCAGCCACAGACACCTACTGGTTTACGCTCTACCAGTTTG
TGTTGGCGTTCGCTTTGCCGTTGGTGATCATTTGCGTGGT
GTTTTTCAAGATCCTCCAAAACATGGCGGCCACGGTTGCA
CCACTTCCCCAACACAGCCTACGTGTGCGCACTAGAAAGG
TCACTCGGATGGCCGTTGCCATTTGCCTGGCGTTCTTCAT
TTGTTGGGCGCCTCATTACATCCTGCAGTTGGCACATCTG
AGTGTGCAACGGCCCAGCTATGCATTTCTATTTGCCTATA
ATGTCGCCATTAGCATGGGCTACGCCAACAGTTGCATTAA
TCCTCTTCTTTACATCATGCTCAGCGAGACTTTCAAAAGG
CAGTTTATTGTTGCCATCCGGCCGGCCCACAAGGACTTCC
GGGCTGATCCGGCCGATGGGAGTGTCAGTCTGCGTTTGGC
CCCTGACGTGGCCCAGCAGTCCCAATCATCTCGAGAGCTG
CTGCCGGTTACTGTGGCTGTGCACTGACAATATTATTCCA
CCTGGGAATCTGCACTGAGTCACACGAACACATTCTTTGT
GTCCGTAATGAGCACG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mchr1b-201 Contained in:
OTHER mchr1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024568 (1)
  • Ensembl_Trans:ENSDART00000039448 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY161858 (1) 1056bp
    CITATIONS (2)