ZFIN ID: ZDB-TSCRIPT-090929-7311
Transcript Name: insl5a-201
Previous Names: insl5-001, insl5a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024445 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024445|OTTDARG00000019776|ZDB-GENE-050310-4 insl5a|OTTDARP00000020173 insl5-001 LG_ BX088595.7 Danio rerio protein_coding KNOWN, 753 bp
GACCAAACTTGTTTGACTTAAGGGGATCGAGTGAAGTTGG
GTGGGGTTTGGCGCTCCGTTCCACAGGTCGCCATAAAATG
GAGTCGCGTCTCTTTCAGAAAACCAGACGTTCGCGAGCGG
GAGATCCAGAAGACCCGAGAGAGACACTTGGCGCGCGTCA
CTGAAGTCACTATGAGGAGCATGTGTCGTCCGGCCGTCCT
GCTGCCGGTTCTGCTGCTGTGGTCTGTGTGTAGTGTGTGG
GAAGTGCAGGCGGATGTCAGGACGGTGAAGCTGTGCGGCA
GAGAGTTCATCCGCGCGGTCGTCTATACGTGTGGAGGCTC
CAGGTGGAGGAGGCTCAGCAGCCCGCAGGATGGAGAAGGT
TTTCTGAATGGAGGGGTCAGCTCCAGTGTTGAGGATCTCG
GAGAGAGTCTGGACTCTGCTGTAAGCAGACGAGACCTCGA
TAGCGTTTGCTGTCAGTTTGGCTGTAAGAAAAGTGACCTG
ACGTTCCTCTGCTGAGCACAGACTCTACTTTTCTCTTCCT
TTTCTTACGCATATTGAGTTCAAGTGAATATGAACGCTTC
TCTATAAAGTGTACATTCAGTTGTTATAACTACTTAATTT
GCAGACAGGTTGTGTTCATTTACATTATTTGGATTTGATC
TTTCTTCTGTATTGTATTTAAAAAAATAATTGTGAGTTGG
TGGAAGGCAGTAATCAATTGTTTTAATTGTATATTGTATT
TTGCAAACTTTGTCAATAAATATTATTGCATAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
insl5a-201 Contained in:
[BAC] DKEY-218B7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024445 (1),  Ensembl_Trans:ENSDART00000104628 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT588328 (1) 690 nt
GenBank:CT584628 (1) 684 nt
GenBank:AM161138 (1) 496 nt
GenBank:CT588329 (1) 455 nt
GenBank:AY834224 (1) 324 nt
CITATIONS (2)