ZFIN ID: ZDB-TSCRIPT-090929-7047
Transcript Name: farsa-201
Previous Name: farsa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024164 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024164|OTTDARG00000019625|ZDB-GENE-050512-2 farsa|OTTDARP00000019993 farsla-001 LG_ AL935209.14 Danio rerio protein_coding KNOWN, 1884 bp
ACGTCATGTCCGCTTCCCCTTCGGAACGCGAGGCGACTCC
AGCATGGCTGACACCGGGCTTTTAGAAGCGCTGCTGCAGC
GGGTGGAGCAGTTGGACGGCGGGGTGGACAGCCAGGATGT
GTCCGCGGCTCTCGGCGTGGATCATCAGCTCGTCGTGGGC
GCCGTGAAGAGCCTGCAGGCGCTGGGAGAGGTGATCTCGG
CTGAGCAGAAATCCTCCAAACACTGGGAGCTGACAGGAGA
GGGTCGTGAGATCGCGGAGCAGGGCAGTCATGAAGCCAGA
GTGTTCAACGCCATCCCGGCTGAGGGGCTGCCACAAAACC
AGCTCATGAAAATGGCGAGTGGGAAGGTCGGTTTCAGCAA
AGCCATGTCCAACAAATGGATCCGTCTGGATAAAGCACAC
GAGGGAGGACCACGAGTCTTCAGGACGGTGGAAAGCATCG
AGGATACAGTACGGGACAAACTACAGCTGGTGCAGAACGG
ACAGTCGGCAAAACTGGAGGAGAAAGAGAAGAACGAACTG
AAGAAACGCAAACTGCTGGCAGAAGTGACGGTGAAGTCTT
ACTGGATCACTAAAGGCAACAGCTTCAGTACCACCATCAC
CAAACAGGAGACCGAACTGACCCCGGAGATGATCGCCAGT
GGGAACTGGAAGGAGAAGAAGTTCAAACCATATAACTTTG
AAGCGATGGGTGTTGCTCCAGACTGTGGTCACCTGCACCC
GCTCATGAAGGTCCGCACGCAGTTCAGGCAGATCTTCCTG
GAGATGGGATTCACTGAAATGCCCACTAATAACTTCATCG
AGAGCTCCTTCTGGAACTTCGACTCTCTGTTTCAGCCACA
GCAGCATCCCGCCAGAGACCAGCACGACACCTTCTTCATC
TCCGATCCAGCATTGGCTCATGAGTTTCCTCGGGATTATC
TGGAGAGAGTGAAGAAAGTTCATTCTGAAGGAGGTTATGG
CTCACAGGGATACAAATACGACTGGAAGATTGAAGAAGCT
CAGAAGAACCTCTTGCGAACACACACCACGGCGGTCAGCG
CTCGCATGCTGTATAAACTTGCACAGCAGGAGAAATTCAC
ACCGGTCAAGTACTTCTCCATTGACAGAGTTTTCCGTAAT
GAGACTCTGGACGCTACGCACCTGGCGGAGTTTCACCAGA
TTGAAGGAGTGGTGGCCGATTATGGCCTCACACTGGGAAA
CCTCATGGGCGTCCTGCACCAGTTCTTCACCAAACTAGGA
ATTACAAAATTGCGCTTTAAGCCTGCGTATAACCCTTACA
CCGAACCCAGCATGGAGGTCTTCAGTTATCATGAAGGTCT
GAAGAAGTGGGTGGAGGTGGGAAACTCTGGGGTCTTCAGG
CCGGAGATGCTGCTGCCGATGGGCCTTCCTGAAGGTGTTT
CAGTCATTGCCTGGGGTCTGTCCTTGGAGAGACCCACTAT
GATCAAGTACGGAATCAACAACATCCGAGAGCTGGTGGGC
CACAAAGTGAACCTACAGATGGTGTACGACAGCCCTATAT
GCCGACTGGACTCATAAACGACCCGATCTCTGCATTGTTA
CAGTGTATTTAAGTCAGAACACACACACCCTGAACACACA
CATCGCCGCTCAGCCATTAATTATGAGGAAACAAAAGAGT
CTTTGCATGAGGAGTGTGACAATGATGTAACACCATCATC
CGATATATAGAAATCCCAGCTGACCGGCCTCCACTGCAGT
CAAAACATCACTTCTGTGTATTTTAGGCTCATTATTTGAT
TTATTATATATATATATATATTTCCACTGAACTTTTACTT
GACAGCTTATTTAAACAGCCAGAATGCAATGGAAAGTCCT
CATACTGCAGAAATGTTCATTAAAAAATCCATTTAAATCT
CCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
farsa-201 Contained in:
[BAC] DKEY-61N16 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024164 (1),  Ensembl_Trans:ENSDART00000164767 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC116564 (1) 1899 nt
GenBank:BC066611 (1) 1870 nt
GenBank:CT655278 (1) 855 nt
GenBank:DN860718 (1) 852 nt
GenBank:CT614223 (1) 803 nt
GenBank:CT617461 (1) 710 nt
GenBank:BM157188 (1) 662 nt
GenBank:AL913262 (1) 539 nt
GenBank:CF101966 (1) 459 nt
CITATIONS (2)