Transcript

farsa-201

ID
ZDB-TSCRIPT-090929-7047
Name
farsa-201
Previous Names
  • farsa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024164 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024164|OTTDARG00000019625|ZDB-GENE-050512-2 farsa|OTTDARP00000019993 farsla-001 LG_ AL935209.14 Danio rerio protein_coding KNOWN, 1884 bp
ACGTCATGTCCGCTTCCCCTTCGGAACGCGAGGCGACTCC
AGCATGGCTGACACCGGGCTTTTAGAAGCGCTGCTGCAGC
GGGTGGAGCAGTTGGACGGCGGGGTGGACAGCCAGGATGT
GTCCGCGGCTCTCGGCGTGGATCATCAGCTCGTCGTGGGC
GCCGTGAAGAGCCTGCAGGCGCTGGGAGAGGTGATCTCGG
CTGAGCAGAAATCCTCCAAACACTGGGAGCTGACAGGAGA
GGGTCGTGAGATCGCGGAGCAGGGCAGTCATGAAGCCAGA
GTGTTCAACGCCATCCCGGCTGAGGGGCTGCCACAAAACC
AGCTCATGAAAATGGCGAGTGGGAAGGTCGGTTTCAGCAA
AGCCATGTCCAACAAATGGATCCGTCTGGATAAAGCACAC
GAGGGAGGACCACGAGTCTTCAGGACGGTGGAAAGCATCG
AGGATACAGTACGGGACAAACTACAGCTGGTGCAGAACGG
ACAGTCGGCAAAACTGGAGGAGAAAGAGAAGAACGAACTG
AAGAAACGCAAACTGCTGGCAGAAGTGACGGTGAAGTCTT
ACTGGATCACTAAAGGCAACAGCTTCAGTACCACCATCAC
CAAACAGGAGACCGAACTGACCCCGGAGATGATCGCCAGT
GGGAACTGGAAGGAGAAGAAGTTCAAACCATATAACTTTG
AAGCGATGGGTGTTGCTCCAGACTGTGGTCACCTGCACCC
GCTCATGAAGGTCCGCACGCAGTTCAGGCAGATCTTCCTG
GAGATGGGATTCACTGAAATGCCCACTAATAACTTCATCG
AGAGCTCCTTCTGGAACTTCGACTCTCTGTTTCAGCCACA
GCAGCATCCCGCCAGAGACCAGCACGACACCTTCTTCATC
TCCGATCCAGCATTGGCTCATGAGTTTCCTCGGGATTATC
TGGAGAGAGTGAAGAAAGTTCATTCTGAAGGAGGTTATGG
CTCACAGGGATACAAATACGACTGGAAGATTGAAGAAGCT
CAGAAGAACCTCTTGCGAACACACACCACGGCGGTCAGCG
CTCGCATGCTGTATAAACTTGCACAGCAGGAGAAATTCAC
ACCGGTCAAGTACTTCTCCATTGACAGAGTTTTCCGTAAT
GAGACTCTGGACGCTACGCACCTGGCGGAGTTTCACCAGA
TTGAAGGAGTGGTGGCCGATTATGGCCTCACACTGGGAAA
CCTCATGGGCGTCCTGCACCAGTTCTTCACCAAACTAGGA
ATTACAAAATTGCGCTTTAAGCCTGCGTATAACCCTTACA
CCGAACCCAGCATGGAGGTCTTCAGTTATCATGAAGGTCT
GAAGAAGTGGGTGGAGGTGGGAAACTCTGGGGTCTTCAGG
CCGGAGATGCTGCTGCCGATGGGCCTTCCTGAAGGTGTTT
CAGTCATTGCCTGGGGTCTGTCCTTGGAGAGACCCACTAT
GATCAAGTACGGAATCAACAACATCCGAGAGCTGGTGGGC
CACAAAGTGAACCTACAGATGGTGTACGACAGCCCTATAT
GCCGACTGGACTCATAAACGACCCGATCTCTGCATTGTTA
CAGTGTATTTAAGTCAGAACACACACACCCTGAACACACA
CATCGCCGCTCAGCCATTAATTATGAGGAAACAAAAGAGT
CTTTGCATGAGGAGTGTGACAATGATGTAACACCATCATC
CGATATATAGAAATCCCAGCTGACCGGCCTCCACTGCAGT
CAAAACATCACTTCTGTGTATTTTAGGCTCATTATTTGAT
TTATTATATATATATATATATTTCCACTGAACTTTTACTT
GACAGCTTATTTAAACAGCCAGAATGCAATGGAAAGTCCT
CATACTGCAGAAATGTTCATTAAAAAATCCATTTAAATCT
CCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations