ZFIN ID: ZDB-TSCRIPT-090929-7036
Transcript Name: inhbab-201
Previous Name: inhbab-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024152 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024152|OTTDARG00000019620|ZDB-GENE-050525-2 inhbab|OTTDARP00000019984 inhbab-001 LG_ BX000484.12 Danio rerio protein_coding KNOWN, 2877 bp
GAGAGAGGGGACAAACAGTGAGAAGCCAGAGAGGGAGAGA
GTGCTAAAGAAAGAGTCAGAGAACTGTCTAACCCTGCCCA
CTTTACACTCAACCATTCAACTCCGGCACGGGCAGCCGTG
CACCGTCAGGTTTCTCCACAGCTCTGCTGCACGGACGCGA
CCCGGAGCTCATCGACCTGCAGGAGGAGAGAGAGGACCAG
CTGCGCTTCCTTCAACTTTTAGCACCATGAACGCTCCGTT
CAGATAAGGATTATTTTGGACTGGCTCCCGCTTTTTCCGT
ATCGATCTGACAAACAAGCCAGTGCGCCGACTGTGATCTT
GGCAGAGGAGCAGAACAGGACTGAGGTGTGAGTCTGCCGT
CACTCAGGATGTCCTCGCTCACGCTCGTGACAGGGGTGCT
GCTGCTGCTCTCCGGCTGTTTGTCAGGGGGCTGCTCGCCT
ACTCCATCTGATAGTGGCTCTCCAGGTGCGGGACGGCCCG
ATGATCCCGTGACCCCCTGCCCGTCCTGCGCTCTTGCCCA
GAGGCCCAAGGACTCTGAGGAGCAGAGTGACATGGTGGAG
GCGGTCAAGCAGCACATCCTCAACATGCTGCATCTGAACA
CCCGGCCCAACGTCACGCACCCGGTGCCCCGCGCCGCCCT
GCTCAACGCCATCCGCAAGCTGCACGTGGGACGGGTGGGC
GAGGACGGCACAGTGGAGATGGAGGAAGACGGAGGGGGGC
TAGGGGAGCACAGAGAGCAGCCTGAAGAGCAGCCCTTCGA
GATCATCACCTTCGCGGAGTCAGGAGATGCCCCTGATGTC
CTGAAATTTGACATTTCCAAGGAGGGCAGCACACTGTCAG
TGGTGGAGCAGGCCAACGTCTGGCTGTTCCTCAAAGTAGC
CAAGGGCAGCCGAGTGAAGGGAAAAGTATCCGTTCAGCTC
CTTCAAAATGGCAAAGCTGATTCAGGCTCCACCGATAGAC
CAGAGGACCAAGTGGTGTCTGAGAAGACCATAGATACACG
GCGTAGCGGCTGGCACACATTACCGGTACCCCGCACAGTG
CAGACCCTGCTGGACGGGGACAGCAGCTTGCTCAGTCTCC
GTGTCTCCTGTCCGATGTGTGCTGAAGCTGGCGCTGTACC
CATCCTAGTGCCGGCAGAAGGAAACAAAGTCAAGGAGAGA
GAACAATCTCACCGGCCGTTCCTCATGGTGGTACTTAAAC
CAGCTGAGGAGCACCAGCACCGGCGCAGCAAGCGAGGCCT
GGAGTGTGACGGTAAAATCCGCGTCTGCTGCAAGCGCCAG
TTCTACGTCAACTTCAAGGACATCGGGTGGAGCGACTGGA
TCATCGCTCCATCTGGTTATCACGCTAACTACTGCGAGGG
CGACTGTCCCAGTCATGTGGCGAGCATCACAGGCTCTGCG
CTCTCCTTCCATTCCACCGTCATCAATCACTATCGGATGC
GCGGGTACAGTCCGTTTAACAACATCAAGTCGTGCTGCGT
GCCCACGCGCCTGCGGGCCATGTCCATGCTCTACTACAAC
GAGGAGCAGAAGATCATTAAGAAAGACATCCAGAACATGA
TAGTGGACGAGTGCGGCTGCTCATAACTCCAACTGTTTAT
TGTTGGTACAAAGCACATATCAGCGGATTGAGGCGGTCTG
TGTTTCACCCACAAACTTTTGAACTGCAAACTCGGACAAC
CTGTCTTGTTTCTGGATCATTCCAACAGGACTGGTTGTTG
GAGAGGTCTTCGTGGCACTTTCATATTAAAAGAAAAAAAC
GATGGAGGGAGAATAAAGCATAATATATTTTTTTTAATGA
AGGAATGGAGACGGGAGAGGGAACGGGTGCATGGGGCAAA
CGTTCAGCCCTGATTCTCTGCACTGCAATAAAGAGACTTA
TTTTGAAGTGTGGAACTATATATTCTGAGAGGAATGAGGA
GGGAAAAAATCATGCAACTCTATGCAAGACAAGTATTATT
ACTGGATGTTCTTCTTTTTATTATTATTTGTCTTTTAGCG
TTTGTTTAATGTTGTTTTTAATGTTGTCCCTTTCCTCACG
AAAAGTCATTTTGTTTAGTGCGTCTTTAAACGAAGTAGTT
GTTTTGATTTCGTTTTTTCTTTTGAGAAATACTTGAACAA
ATTTAGTTTGACCAGCTGCTGGAGCCAAACTACTTTATTA
TTATTTTTATAATATTATTATTATTGATAATCACCTATTA
ATATTATTATTTTTCTCCGAAACATTCTGAATGTTAAAGA
AAAGTAATATAAATTTGCACTAAGCCAACATTTGTACCAT
GTGAGCCCCAGAGAACTGCGGGCCGCATTCCAGTTGCCAT
ATCATAGTCTAGAACCATAAACATTTGGTTAAACTTACAC
ATAGAAAACCAAAGACCATACACACCCTGTTCACAGAGCA
AATCCCCAAAACGCCCGGCTCGGTGAATTTAATCAAATTA
GGAAACAACTGTGTATGGCCAACATAATACCATTAACTCA
ATATAGCACATAAAATAACTTTTTTGTTTTGTTGTTTGTT
TGTCCTTTTCCTGAAACAGCCTCAATGTTAAGATACTTTT
TGCTCTCTGTGTTTTTTCGACAGTGTTTGTCTCTGCCAAC
GTATAACAAAGGTCTTAGTATCTGAACTGAAACCTAGCCT
TCAGATGCTGTTCTCCACAGAAATATTCAGAGATAGAAAC
AATGTCCTGGCAATGTTGGGTTAAAAGTACAAGACGCTAA
AGGAATTTACTTTGTTTTATGTAGAGTTATGCAACATATG
ATTTATTTATGTGTTGCTATGTTGTAAAGAAAATCGAAAT
ATGTGCTTGTCATGTTTTATATCTAATTTATTTTGCAGCA
TATTCTTTGCTTCACTATTAAAAGCTGAATTGTACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
inhbab-201 Contained in:
[BAC] CH211-12E1 (1)

Genome Resources: Vega_Trans:OTTDART00000024152 (1),  Ensembl_Trans:ENSDART00000047468 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY962560 (1) 2528 nt
GenBank:CK147616 (1) 832 nt
CITATIONS (2)