Transcript

rtn4rl2a-201

ID
ZDB-TSCRIPT-090929-6997
Name
rtn4rl2a-201
Previous Names
  • rtn4rl2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024110 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024110|OTTDARG00000019590|ZDB-GENE-040310-4 rtn4rl2a|OTTDARP00000019950 rtn4rl2a-001 LG_ BX908740.5 Danio rerio protein_coding KNOWN, 1565 bp
ACTCTCTCAGTCGCTCCGACTCGGGAACCAGAGCATCAGC
GGAGATAGCAGAGAATCAGTCTCTAAACTCCTCAGGCTAA
CTCGCTCTCGGCTTTGGTTCGGAATGGAAACATCAACTTT
TACGCGGAGCCAACGCAGCTCCTTTGCGCACAACTTTAAG
AGCGCGCTCTCGCTCTGGCTGGTTGTCTGGCTGGTCGTGG
TAAAGCCGGTGCCTGCGCAGAACTGCCCGCACCGGTGTGT
GTGTTATCCGACCCCAATGACGGTGAGCTGCCAGGCGCAG
AACTTTACCATTGTACCCCACGGCATGCCCTACGAATCCC
AGCGCGTTTTTCTGCAGAACAACCGCATTACTGAACTGAG
AGTGGGGTCTTTTGCTTTTGGCACACAGGTTTTGTGGCTC
TTCTCCAACAACATCACTTGGATTGAGGCCGGTGCATTCA
GTGAGTTGCGCGATCTGGAGGAGCTCGATCTAGGTGACAA
CCCAAACCTGCACCGCCTTGAGGGTGGAGCTTTCCGGGGC
CTAGAGAAGCTCCAGAGCCTCCACATGCACCGCTGCAAAC
TGGCTGCCCTTCCCCACGACATCTTTCACAAGCTCTACAG
CCTGCAGTTCCTCTACCTGCAGGAGAACCAGCTCCACTTC
ATACAGGATGATCTCTTCGCCGACCTGATCAACCTCAGCC
AGCTCTTCCTGCATGGCAACCGCATCCGCACCCTGTCCGA
AAATGTGTTTCGTGGCCTAGTCAACCTCGATCGACTGCTC
CTGCATGACAACAGGGTCCGTCAGGTCAACCGCCGTGCCT
TCCGGGACCTGGGCAGGCTGACCATGCTCTTCCTCTTCAA
CAACTCTCTGGCGGAGCTGCCCGGTCAGGCCATGCGTGAC
GTCTCCTCCATAGAGTTCCTCCGGCTGAACAACAACCCCT
GGGCGTGTGGCTGCGAGGCTCGCCCCCTGTGGGAGTTCTT
CAGAGGTGCCCGTCTGTCCAGCTCCGAGGTTCTGTGTGCT
TCCCCAGCTTCTCGCCGTGGACAGGACCTGCGCTTTCTTA
GGGAGATGGACTTCGCCCTGTGCCCCCTTCCCGACCCCGG
CTCCCTGGCTGGCACCACCACCACCACCTTCAGCACCAAG
ACCCGCTGGTGGTTCTCCAAGAACAAGCCTGTCAGCACCT
CCAAAGGTATCTTTGAGAAGAGCTCCGAGACCAAGGCACA
TCCCTACACTGGAGGAAAATCTTCAGTCACATCTACATCC
ACAAAATATGAGCTTGGCGAGGAAGAAGCTCTGCTTCCCA
AGCTCGACCCAGAAGAGTATTGGGCCAACTATGGCAATGA
AGATGCAGGCATCACCTCCCTGCGCTGCTTTGAGCTTGAG
TGCCCTCCAGAATTCGACTCTCTGCCACCATCTTCCTCGT
CTTCTCGCTCCTCGTCTTCAACATTCTTGCTACTCTCCAT
GTCTGTTTTGACTGTCTGCATCCACCTTCTCTTTGGCTGA
ATCTGTCCCTCTCAGATGAACTCTTCTCCCCCTCATTTTT
TCTCCTCTCTGAAGGAGGGAAAACCCCGTTTGCTCGGTTT
AACTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations