Transcript

kctd12.2-201

ID
ZDB-TSCRIPT-090929-6996
Name
kctd12.2-201
Previous Names
  • kctd12.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024109 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024109|OTTDARG00000019589|ZDB-GENE-060117-4 kctd12.2|OTTDARP00000019949 kctd12.2-001 LG_ BX901972.12 Danio rerio protein_coding KNOWN, 1479 bp
ACTCTTCTTCAGTTCTGTGATTGCACTGGAGGTCTCGCGC
AGCTGTGCAAAGATGGATAAGACTCGCGCGGACGCTTCTT
CACCGCGATTCTCCGAAATCATTGAGCTCAATGTCGGAGG
GCAAGTTTACGTTACGCGCCACTCAACTTTGCTCTCCGTG
CCCAATTCTTTACTTTGGACCATGTTCAGTCAGAAGAAAC
CCGCGGAACTTACTACCGACAGCAAAGGACGCTTCTTTTT
GGACAGGGACGGCTTTTTGTTCCGTTATATTTTGGATTAC
TTGCGGGACCAGACTCTGGTTTTGCCTGATTACTTCAAAG
AGAAAGCGAGCCTCCTCAAAGAGGCAGAATATTTCCAACT
TCAAGACCTGGCAAAGCGCCTGAAACCTGCGGTCAGTAAG
GAGAACTCCATCAGCGAGGAGGTTTGCCAGAGCGACCCGG
AGGAGGCTGCGCTCGCCGGAACCAGCATGACCTGCACCGG
CCCCCGCTCACCGTCTTTGGACGCGAGGAAAACCGGCTTC
ATAACCATCGGGTACAGGGGCTCCTACACTATAGGACGAG
ACCTTCAACAGGACGCCAAATTCCGACGGGTGGCGAGAAT
CACTGTGTGCGGCAAAACGTCTCTCGCCAAAGAAGTTTTC
GGGGAGACGCTGAACGAGAGCAGAGACCCCGACAGACCCC
CAGAGAGATACACATCTCGGTATTACCTGAAGTATAATTT
CCTGGAGCAAGCCTTTGACAGGCTGGCAGAGGTGGGCTTC
CACATGGTTGCGTGCAGCTCTACGGGCACCTGTGCGTACG
CGAGTAACGACCCCAACGAGGACAAAATCTGGACGAGTTA
CACCGAGTATGTTTTTTGTAGGGAGTGAAGTACTGTAGTG
GACTCACTTGGGAACTGTTATTCAAACACATTTCTCGAAC
ACTCACATTTCTATTCGTTGCGCGCAACGAACGTGTAGTT
GTGTGCCACAATGTCAATATGTCAAGACGAATTAGGGACC
ATCAATCGCTGCGAAAAAAAAAAATATGCATATTTTGTGT
GTAAAAATAATTTAACTGCGGATCAACTAAATCTGCTGTC
TGTTCTCAGAAGTTTTAGCATTTAGTTGGAGAAAGCACAA
AATATACTCTGAATAATCAAATTAGTACCACCAAAGTTTT
TAATATTATGTGAGTTTAACAGTGAATCACATTCACACTT
GTATTATTTTCTATCAATTTATGTGGGATTATTGTTCAGC
TTTTTATTGAGTAGCCTGCATCCAGAATCTTAGCAAACAA
AACAAAACTAAATGTCGACCAGAATATTAATTTAGCAACG
TTTTCTAAAACATTTACTCCCACCCGTCTGCTTTTCACTG
AACCTTGATGCATCACATTTGTTTTTGTTCGTGTGTATTT
GCACTATGTGTTTTATTTTTTTCTTATACAACATGTCTGT
CAGCTTCACACACATAATAAACTAATCATGAAAGACACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations