Transcript

prdx2-201

ID
ZDB-TSCRIPT-090929-6918
Name
prdx2-201
Previous Names
  • prdx2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023985 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023985|OTTDARG00000019507|ZDB-GENE-030326-2 prdx2|OTTDARP00000019863 prdx2-001 LG_ BX548032.5 Danio rerio protein_coding KNOWN, 1018 bp
GCTGCTCGCTGGTTTTAGAGCAGGTCGCGCGGTTGCCACT
TCCTGTGCGCGTGCATCAAGGCAAAGAGAACTTTCTCGTC
CACACAGAACAGTACCAACAAGCAATCTTCAAGATGTCTG
CTGGAAACGCTAAGATCGGTCAGCCTGCTCCTCAGTTCAA
GGCCACAGCAGTGGTAGATGGACAGTTTAAAGACATTCAG
CTCTCAGACTACAGAGGGAAGTATGTTGTGTTGTTTTTCT
ATCCTCTTGATTTCACCTTTGTGTGTCCCACCGAGATCAT
TGCGTTCAGCGAGCGGGCAGCAGAGTTTCGTAAAATCGGT
GTGGAGCTCATCGCTGCCTCCACAGACTCTCATTTCAGCC
ATCTAGCATGGATCAACACACCACGGAAGCAGGGTGGCCT
TGGCTCCATGAACATCCCGCTGGTGGCCGACCTGACACAG
TCTATCTCCCGTGATTACGGAGTCCTGAAGGAGGACGAGG
GCATCGCCTACAGAGGTCTGTTTGTGATTGACGATAAGGG
CATCTTGAGGCAGATCACCATCAATGACCTGCCGGTGGGT
CGATCTGTGGACGAGACTCTTCGACTGGTGCAGGCCTTCC
AGCACACCGACAAATACGGAGAAGTTTGTCCTGCTGGATG
GAAGCCAGGAAGTGACACCATCGTTCCCGACGTGCAGAAG
AGCAAGGAGTTTTTCTCCAAGCAGTAACAGTCTCTATTTC
TGCATTCACTGGGCTGTTGAAGCACTTAAATTCAGCCTGA
GGGGGTCTAGAAAAGTTGATTTAGCCATCGTAACAAACAC
AGGTTAAATGCACTAGTTAGTCTGATTTCTGTCTGAAGAA
GCCGTTTCAGCCCGCGTCTCTCATGCACTGAAATATCTGT
AGTTTGTGTTCAGCTAGTTAGTCTGCATTGCATATTTGGT
ACTCTGTGAACATAGCTGGTTTTAAATTCTCTCAAGTTGT
TGGCATTCTGGTGATTTTGTCAATATCTCTGTTAAATAAA
CAGGCTGTTATTGCTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations