header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6681
Transcript Name: sstr3-201
Previous Names: sstr3-001, si:dkey-165i8.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023679 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023679|OTTDARG00000019314|ZDB-GENE-061009-35 sstr3|OTTDARP00000019644 DKEY-165I8.4-001 LG_ BX571960.6 Danio rerio protein_coding KNOWN, 1563 bp
GTCATAGTTTGTGGTTGTTCTCTGTGCAGGACAATGGCCC
CTAGCTGAAGGCAGTGACGGCATAAGAGTGAGATGGAGCT
GACCTCAGTAGACGCCTCCGCAGCACTGGACATATGGAGC
AATGGCTCCATTCCTGGTTTTCTTCTCAACGAGAGCATTC
TCAATGACACCTGCTTCCTCAATGTTTCGAACTGCACCAA
TGGGACAGATGCGGGCAACCGAACAGAAACAAGCATGGCA
GGAATCCTCATCCCTCTCATTTATATCATCGTCTGCATCG
TTGGCCTGGGAGGAAACTCTTTAGTCATTCACATTGTCCT
GCACTACTCTAAGACTGAGTCGGTGACCAATATCTACATT
CTGAATCTAGCTATAGCTGATGAGCTCTTCATGCTGGGCC
TTCCGTTCCTCGCCGTACAGAATGCCATGCATTCCTGGCC
CTTCGGCTCATTTACGTGCCGGCTCGTCATGACTGTTGAT
GGCATTAATCAGTTCACCAGCATTTTCTGCCTCACCGTGA
TGAGCATCGATCGATACCTGGCTGTGGTTCACCCTATTCG
TTCCTCTAAATGGAGGCGACCTCAAGTAGCCAAGGCTGTG
AATGGAACGATCTGGGCAGTATCTTTTCTAGTGGTCTTAC
CTGTGGTGATTTTCGCAAGTGTTCAACGGGAAGGTGGAAT
CTGCAACATAATATGGCCGAAGCCAGCCAATGTTTGGGCA
GCAGCATTCATCATCTACACCTCCACAGTTGGCTTTTTCT
TTCCCTTGCTGGTCATCTGCATGTGCTATCTGCTCATTGT
AATTAAGATCCGCAGCTCGGGAAAGAAGGTTCACGCAACA
TCCACCAAACGCCGTAAGTCGGAGCGGAAGGTCACTCGAA
TGGTAGTGATTGTCGTGGCTGTGTTCGTGTTCTGCTGGAT
GCCGTTTTACGCCCTCAATATAATAAACCTTGTGGAGTCG
CTGCGTGATGAACCACAAGGCCTGCATCTTTTCGTTGTGG
TGTTGTCTTATGCTAACAGCTGCGCTAACCCTATCGTTTA
CGGCTTCCTTTCGGACAACTTCAAGAGAGGTTTCCGGAAG
GCCTTGTGTCGCTCTTCTCGAAGGGTCGAAAACCACGAGC
CCACCGAGCAGCAGCAGCATCAAGAAGAGCGAAGACGAGT
GCTGATGCCAAGGGAAAGCCTTAGAAGAGCAGTTAGAGAT
GAAGAAGACGAGGAGGAAGAAGAATACAGGGAAGAAGTGA
CAGAAATGACGGAAATCTGCAGGATTACTCAGAATGGAAA
TGGAAGCGGACAGCCTGAAAGTACCCGAGCGCTTTTCTTA
GAGAGACCCTCGGGCACAGGGGTTTCAGAGGTCTGTTCCC
CTGACAGGAGAGGTGCGTGCGGGGATGTGGTTGGTAAAGG
ACCAGGCTTTGGACCTGCTGCAACCCTGTTGAATGGGGCT
AAAAATGGCAATGTGAAAACTCTGCCAGAGGAACCGGTGG
AAAAGAACAGCTCCCTGGAGATCAGCTACTTGTAAACCTT
GTGAGTTGTGACAGCTGGATAAACAGTGTTATTGTACATG
CCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sstr3-201 Contained in:
[BAC] DKEY-165I8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000023679 (1),  Ensembl_Trans:ENSDART00000048867 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)