ZFIN ID: ZDB-TSCRIPT-090929-6668
Transcript Name: cdc42l2-201
Previous Name: cdc42l2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023666 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023666|OTTDARG00000019307|ZDB-GENE-060312-21 cdc42l2|OTTDARP00000019638 cdc42l2-001 LG_ CR356239.11 Danio rerio protein_coding KNOWN, 1591 bp
AGCGTGGTCTGGAGAGACAACCACAGCCATTACAAACTTT
TCCCTTGTAAATAGTTTATTCTTATTTTTGCGATGATTAG
AATCGAAGTTAAAAGTATTTGTATATGTGAAACGTTTACG
TAGTTAACATTAGACAAGTTTATTTTAGGTTTAAACATGT
TTCGTCAGGCTGTTAAGAAACTAGATTCTTTCATGCCAGA
TGCTGACAAACAACTTGTGGCAACAGCGATGTCCACAATT
AAATGTGTGGTAGTTGGAGATGAAGCTGTGGGTAAAACCT
GCCTTTTGGTGTCATTTACAAACAAGTTCCCATCAGAACC
AACAGTGTTCAACACCCAATCTGTGACTGTAATGATGGGT
GGTGAGCCGTACACCATTAGATTATTTAATGCTGCAGGTC
AAGATCAATTACGGCCCCTTAACTATCCCCAAACAGACGT
CTTCTTAGTTTGCTTCTCTGTAGTTTCTCTTTCCTCGTTT
GAGAATGTGAAAGAAAAGTGGGTGCCTGAGATAACCTTTT
ACGCACCCAAAACCCCTTTTCTGCTGGTTGGAACTCAGAT
CGACCTACGAGATGATCCTGTGACCGTTGCAAGGCTTGCA
AAAAACAAACAAAAACCAATCAAACCAGAGGCGGCGGAAA
AATTAGCCAGAGAGTTAAAGGCAGTGAAGTATGTCGAATG
CTCTGCTTTAACACTGAAAGGACTGAAGAATGTATTTGAT
GAGGCGATATTAGCAGCACTACAGCCTTCAGGGTCCCAGA
ACACATGCAAATGTGTCATCACATGAGCTGGACAAAGATT
AAATTTCAGAAATGTTTCTGAGTGTGAACCAACATGATCT
TTTTATTTTTCTACAGGCTTTCATCTAACAGGTGCTTTGA
CTTTATTGTTTATTCTACCGTTGTTTCCTGGTCATATGAT
GATTTGTGTGTAGCTTCTACTCTCTGTTGTGAAACCACAG
CCTTCAGGTTTCAGAAGGATTCAGATATTAGAGGGAATTA
GGGGTAAGTTGCACCACTTTTTATTTAAATGGAAAGTAAA
GAATTACAATTATATTTGTAAGTGTTTAGTGTCTATATTT
ATTTACATTATTTCTGGTATTTATATTTTGAAGAAAACAA
AGCTGTCGAAATGTTAATTGGTATTTTGATTTGAGTCACT
GTCTGGACTTGCAATATCTGAAAAAATAAATGTATTTTAA
TTATAAAGGAGAGTTAGAGACTAATAATGTGAAACATTTT
TTAAAGAATGATTTATAGAAGGCATCTACTAAAATGTAAA
CACTTTACACGACAGTAACTATTGTCTGTCATATTAAGAA
CAAGAGTCTTTTGATGAAATTTAAGAATCACAGTGCAGCT
TTATAATACTCATTAAGTGTCATTTAAATCTTTTTACTTT
GTCCTTCAAGCCACTAGCTTTGTTAGCAAGATTTTAGTAA
GCACAAGTCTGACTTTCACAGGTTTCATTTTGTCATGAAT
ATATCCGTTCAGCCAACTGACAATGAACCTTCGAAATGTT
GATTGAGTTAACTGAAACTTGCATTTAGTAAGTGTATAAA
ACTACTTTGGAAATAAAACATTTGATACAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdc42l2-201 Contained in:
[BAC] DKEY-147F3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000023666 (1),  Ensembl_Trans:ENSDART00000142546 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC114307 (1) 1615 nt
GenBank:DT069787 (1) 756 nt
CITATIONS (2)