Transcript

cd2ap-201

ID
ZDB-TSCRIPT-090929-660
Name
cd2ap-201
Previous Names
  • cd2ap-001
  • cd2apl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006191 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006191|OTTDARG00000005685|ZDB-GENE-030131-8078 cd2ap|OTTDARP00000005506 cd2ap-001 LG_ BX511269.12 Danio rerio protein_coding NOVEL, 3764 bp
GGGATAACTTCCTGCACAGTACTCTTAAGAAACATACCTC
ATATTTAAACAACAGGCCGACGTTTAAAAGCAAGTCGAAT
GGATTAATAGCGCCAATAAACTCGCTAACAAGCACTTCAC
CAACACGATTCCACGCACAAGTAGGATTTACGGCTAGCAT
CCAGGCTGCTAGCTAACATCAGCTACCAGGACGGCAGATT
GTACACATCAGATCAAGACGGTCTCGTATCGAAGGACAGT
ATGGTTGAGGTGGTGGTGGAGTATGAGTATGAAGCCCTCC
ACGAAGATGAGTTGACCCTCAGGCTTGGAGACATCATCAA
AAACGTACGACGCATCGAAGAGGAGGGATGGATGGAAGGA
GACCTCAACGGCAAACGAGGCCTTTTCCCAGACAACTTTG
TAAAGGAGGTGAGAAAAGATGAGCCGAAGTCCAAAGAGGA
GTCAAAGGAGCCTAAAGAAGCGAAGGAGGTGAAAGAGGAG
AGTACGATACAGCGGCGAGCATCAGGGAATGTAGCAAGCC
TGGTGCAGAGGATCAGTACATACGGCATCCCTGCTGGAGG
AATCGGCTTACAGCCCCATTCTCAACCGCGTGCCTCAAAA
AAGAAGCTCAAGAAGCGTCAGTGCAAAGTCCTATTCGAGT
ATGTGCCTCAGAATGAAGACGAGCTGGAACTGAAGGTTGG
AGAAATCATTGAAATCACAGAGGAGGTTGAGGAGGGCTGG
TGGAGCGGAAGTATGAATGGGAAGTCTGGACTTTTTCCTT
CCAACTTTGTCAAAGAAATCGATTCAACTGAAGACGCAGA
GAACAGTGACGTTACTGAAGAGCAAGATACAAGAGATGGC
ACGTCTAGCCCCACGTCCCCTCATCCAGGCAATGGGGTCA
TGGCTCAGCCAAAGAAGATCAAGGGCATCGGCTTTGGTGA
CATATTCCGAGAGGGCTCTGTAAAACTCAGAACCTCCCTA
AAAGGACCATCTGAAAATATGGAAAAAACAGAAAAACCAA
TTCCTCCATTACCATCTGCCACAAAACCCACCCCTTTGAG
CACTCCGGAACACCCTAAAGGAGAAAAAGAGGCAGAGAGC
AAAGCTAAAGTAAAAGAATACTGCAAGGCCACATTCCACT
ATGAAGCAACAAATCAAGATGAGCTGGATTTGAAGGAAGG
TGAAGTCATCCTTATACTGAGCAAGGACACAGGAGAGCCA
GGCTGGTGGAGAGGAGAGGTCAACGGCAAACAGGGAGTTT
TCCCGGATAACTTTGTATCTCTGCTTCCTGAGTCAGACAA
AGAGACACTTACATCCAAAGGCTCCATCAAAGTGTTATCT
AAACAGGAACCAGAGGAGAGACCAAAGAAGCCGCCTCCAC
CATCCAAAAGCACAGTCCTGAAACCAGAGACTCCAAGTGT
GGACAAGAAGCAACCGCAGCCACGGCCGGAAGATAAAGTT
GTCAAGCCCTTGCCAGAGAAACCCGCCAAACCTGCAGGCC
CCATCGTGCCCCCGAAGAAACCTGTGCCTCCAAGCAAGAG
CCTCCTGCGTCCTTCATACCACACCAAACGGCCTGACTTG
CCTCTTACTCCATCACCAGCCGCCAAGCAAGTGCAAAATG
GAGACGTTCCTCTCTCACGAAGAAAATCTGAGTGTGAACC
TGTTCCCATCAAGCCAAAAACTGTTGTGGATATTGGTGAA
AAGAGTACAGAAACTGTTAATCTCATGAGTTTTGATGATG
TTTCCTCTTCCTCTGAGAAATTAAGCCACCCTACTGCACA
GCGACCAAAGATGCCTGGGAAAAGACCACCTGCTCATAGA
GGCCACTCCCCAAGCAAGGATGTTGGAGAGAAAGCTGAGA
AAACAGAGAAAATAGATGAAGTTGAAACCGCTCCTTCTCC
TGCGCCTGCTCCTGCCCCTGCTCCTTCCACGCAGAATTCA
ATTAAGATGCCCATTTCATCCCCGTTACCATCTACAACAC
CTAAAACAATTTCAGCCACCCTTATCACCCCTGAACCCAA
ACCAAAACCTGACAAGGAACAGGAGAAGACATCTGAACTG
GAGGAGTTAAAGGATCAGATAAAGGACCTGGTGCTCTCTG
TAGAATTACTGAAGACACAGCAGTCGAGAGAGCTTGGCGA
ACTTCGAAAAGAGCTGGATGATGAGCGACTCAAACGCGTG
GCCCTGCAGATGGAGATAGACAAACTGAAGAAGATATGTG
TACAATCCACATGAAATCATGGCATCAGAACTGGACTAAC
AGCTCTGCTGTTGTGTTAAAAGTGGAAAGCGACCTCTACC
AGGAGGGACTGATATCATTCGCATCATCTTCTCACTCGCT
GACTTACTCCACAAATTGTAAGATTCACATATTTGCACAT
GAGTTTTCTAGGTTTAGAAAGTCTAATTATGACAGATGTA
TATGTTTGTTTTTCCTTTTTTTTTGCCAACAAAAAATGAT
TGAGGCCTTACTTTACTACTGTGCTGGATATGCAGTCTGT
GCACTAATTGAGAAGTGCAGCGGATTATGCATTTAATACT
ACTGAATCTGTATAAACGTTGGGGGATTATGTTGTTTCCT
TGTGTTTTTTTATGACATGGGTTAGTTTTTAAAGAAAACT
ATTATGATCTCAGCAATATTCTGTCTATATTAGCCTCTTT
AGATGATTATCAAATGTACGGCATATTCTCTTTTTTTTTT
TCTATGGTAATGATGTATTCTGTTGTTGATGTTTCAAAAG
GGAGAACGTTTCTTTTGTTTTTCTCTAACATTCCTATCCA
GGGTAACACTATTGTGCCTGTTAAGATTTTTACAAGTGTT
AATACTGGGAGCTCTCATACTATATAAATATATATATATA
AATATATATGTGTATACTTAGATCTACAGCATGATATATA
TTTTTATGGTCTATTGATTGTGACATCATAAAAAAATGTA
CTGGGTTTGTGTATTCATGTTTGGTTAAAAGTATTCACAC
CCACCCACACAAATGAGCTTAGGTAAGCTGTGCCATTTCA
CCATACGAATGGCAGGAAACCCATTTTGCAATTTATGGCT
CTGTTTAATAGCAGCGTTTGGGTTTGTTCTGCAGTTCTAC
CTCCAAATATCACACTGAAATTGGAAAGATCCTTTTTTTC
TGGATAAACCCCTGGCTGGTTGAATAGGTTAAACTTCATG
AATGGTGAATCGCAGATGATGAACACATCTTGGGTTAGAG
ACTGCTGGCTGGCACAGAATGTCTGATATTTATCAGTAAA
GTAAAGCCAGGTACTCTTTGTTAAACAGAATTGTATCCAT
CCGCCTTTGGTTTTGCTATACGAGTATGTACCGCTGACCA
AAATGAATCTTTCATTCGGTTTGTTGTAATCCTTGAAAAA
CGCACACTTTCAAGAACACTTAAGTGTGCTCATTCCTCAA
GTTGCTTAATTCTTAAACTGAAGAAATGCATTTTTTAAAG
CATTCCCGATCAAAGGTTGTTTGTTGTGTGGAACTGATTG
ATTAGGGTGGCAGGTCGATCGCTAAAGCAATAAACAGACA
CATCTTTCTTGTTTCCGTTTATTTTTTTTTGTGTGTCCAA
TTAATGTTCTGGTGCAAAATTAGCGCTCTGTTTTCCGAAA
TTGGCGAAAATGCATTCCTTTTTACTATTTCAGGTCTTCA
GATCTGTTGTGCACATTCAGCATCTATCAAAATGAACTTG
TTTACATGATTTCAAACTAAATTGCATGAGCTGAGTTATT
TTTTTTTTCGCAAACTAAATAAATATCATGTTTATTTACA
GAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations