ZFIN ID: ZDB-TSCRIPT-090929-656
Transcript Name: slc5a6a-201
Previous Names: slc5a6a-001, si:dkey-5g7.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006180 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006180|OTTDARG00000005674|ZDB-GENE-041001-177 slc5a6a|OTTDARP00000005495 DKEY-5G7.3-001 LG_ BX255939.3 Danio rerio protein_coding KNOWN, 2320 bp
ATTCATCGCCTGAACTCTGACCAAGCACGTCACCTGCAGT
CCTCGGTAATGATGACCAAATGGACCACTATCCACTGACC
CTTCACTGACCATCCAGGAGCCTCATTGCTCCGTGTGTTC
CTCAGCATGGGGGACACTGTCCAAATGCACTTCAGCACGG
TAGATTATGTGATTTTCGTCGTGCTATTAGTGGCATCCGC
AGGAATCGGCCTTTACTACGCCTTCTCAGGGGGTCGGCAG
AGGACCACACAGGAGTTCCTGCTGGCCGACCGTAGCATGC
GCTGCCTTCCCGTATCACTTTCACTGTTAGCCACCTTTCA
GTCAGCTGTGGCCATCCTGGGTGCCCCGTCTGAGATCTAC
ACCTATGGCACACAGTACTGGTTCCTAGGCTGCTCCTACT
TCCTGGGCCTGCTCATTCCTGCACACATTTTCATCCCAGT
TTTCTATCGCCTCCGCCTCAGCAGTGCATATGAGTATCTG
GAGCTTCGTTTTAGCAAAAGTGTTCGGATATGTGGCACTG
TGACCTTCATTTTTCAAATGGTAATCTATATGGGAGTTGT
CCTGTATGCTCCTGCACTTGCACTTAATGCAGTAACGGGT
TTTGACCTTTGGGGGGCAGTGCTGGCAATGGGGCTAGTTT
GTACACTTTATACAGCATTGGGTGGTCTGAAAGCAGTGAT
CTGGACAGACGTGTTTCAGACAATCGTTATGTTTGCAGGG
CAACTGGCAGTGATCGTGGTGGGCACACACCAGGCAGGCG
GCATCGCTGAAGTGTGGAGGAAAGCACAAAATGGCAGCCG
TATCGCAGGCCTTGATCTGAACCCTGACCCTTTAGAGAGG
CACACTTTCTGGACCCTAGGAGTTGGAGGTGTTTTTCTCA
TGCTGGCCCTGTATGGAGTGAACCAGGCTCAGGTCCAGAG
ATACCTCAGCTCCCGCACGGAGAAAGAGGCCATCATGTCC
TGCTATGCGGTGTTTCCTTGTCAGCAGGTTGTGCTCACAT
TGGGCTGTTTGATGGGTTTGGTTATGTACGCTCGATATGG
GGAGGAAAGCCCTCTGGATCAGGGCTACGTTACAACTAAT
GATCAGATGGTGTTGTATTTTGTAATGGATGTGTTGAGGG
ATCTTCCTGGTTTGCCAGGACTATTTGTCGCTTGCCTTTT
TAGTGGAGCTCTAAGCACAATCTCATCTGCCTTTAACTCT
CTGGCAACAGTAACCATGGAGGACCTGATCAAACCTCATG
TCCCAGCCATGACAGAGGCCCGCGCCACTCTGTTATCCAA
AATGTTGGCTCTTGCCTATGGGCTTGTGTGTTTGGCTATG
GCGTACATCGCGTCCTTAATGGGGTCTGTGCTGCAGGCAG
CACTCAGTATTTTTGGGATGGTGGGAGGACCTCTACTTGG
TCTTTTTTGTCTCGGGATGTTTTTCCCTTGGGCCAATTCC
ACTGGTGCACTGGTTGGACTGGCATCAGGACTGGTCATGG
CTTTCTGGATCGGCATCGGCAGCTTTGTTTCACGAATGTC
TCCCTCTGCACTACCTGTGATCAATGCCACCATCATACCC
GATGTGGGAAACATGACGACAGCTGTCATGACGACACTCA
CCACAACTAAACCCAGGCCTTCTGGAGTTCAGGCTCTGTA
CTCTTTGTCATATATGTGGTACAGTGCTCATAATTCAGCT
ACAGTTGTGGTGGTGGGACTGGTGGTCAGCTTTCTTACAG
GACCCTGGAAGGAGAAAGATTTAAACCCAGGTACGGTTTA
TCCAGTGCTTGGAAATTTGCTGTTTTTTCTGCCTCAGCGC
TACAGGGAGAAACTCTGCTGTGTAACTCCTCTGGAAGACA
AGTCCAAAGATCTGGACCGTCAACCTTACCAGATGGCCCA
GAAAGAGAGCAACGGTGTAGCCTGCACTAAAGAGGAAGAC
AAACTCAGGGAAGAGGAAGGAGAACGTGTAACTGCCCAAC
CGACTTGTAACCTCGCCCATACTCTACAAGAAACAGCCTT
GTGACAACAACAGTTCAAGGGTAACTCAATCTCCTGCAGG
CTTTAGGAGAAAAATGTTGGTTCCGATGCCAAAATGGTTT
AAATGTACGACCTCACCGTTCCCTCCTATCGAATTGGTCC
ATAAGCTGTGGTTTGTATCTGCAATATTGGTACGATGTGC
CCTGAACTGCCAGTGATGGAGGTTTGGGGGGTTGTCTGTT
TATATGTGCTGCTTCATGATGCCAGTGGTCTGTTTTATCG
AATTTGAGATCCCGTTAAATGAACTCGCTCAAGAGATCAA
CTAAATAATTTTGTTTACTCGTCCTAAAATTGAATCTTTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc5a6a-201 Contained in:
[BAC] DKEY-5G7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000006180 (1),  Ensembl_Trans:ENSDART00000134819 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CV489221 (1) 866 nt
GenBank:CV117481 (1) 772 nt
GenBank:EH565367 (1) 536 nt
CITATIONS (2)