ZFIN ID: ZDB-TSCRIPT-090929-655
Transcript Name: rpl7l1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006179 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006179|OTTDARG00000005673|ZDB-GENE-030131-970 rpl7l1|no_translation rpl7l1-002 LG_ BX255939.3 Danio rerio protein_coding KNOWN, 497 bp
ACAGCAAACGCGATGGCAGAACCAGGAACTGAGAAAGTGA
TCAAGCTTGTTCCTGAGAATCTTCTCAAGAAACGCAAGGC
ATACCAGGCTATCAAAGCCAATCAAGCTAAACTTGCTTTA
CAGCAGAAGAAAAGGGTAAGAATTCTTCTATGTGTTAATA
GTCCAATAATTACTTCAAAAACAAACTAATAAACTAAATA
TTTCACCAGGTCCAAAAAGGAATCCCCTTCAAGTTTAAGC
GCTTGGAGGAGTTTTTGCAAAACAGCAGGAGAAAGCATCG
AGATGAGACCAGGCTCGCCAGACTCAAAAAGAGACCTCCA
CCACCCATGCCACCAGCCAAGAACAGCCTGGCATTCGCTG
TCCGCATTAGAGAGATCAAAGGTGTGAGCCCTAAAGTGAT
GAACGTTATTCAGATGCTGAGACTCAGGAAGATCTTCAGT
GGCACCTTTGTCAAAGTCAGCAAGCATTCAATAAACATGC
TTAAGACTGTGGAACCT

rpl7l1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rpl7l1-201 (1)    Ensembl 1032
ncRNA rpl7l1-002 497
rpl7l1-003 (1)    Ensembl 776
rpl7l1-004 (1)    Ensembl 819
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpl7l1-002 Contained in:
[BAC] DKEY-5G7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000006179 (1),  Ensembl_Trans:ENSDART00000143627 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AI477738 (1) 497 nt
CITATIONS (2)