header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6524
Transcript Name: rpa3-201
Previous Names: rpa3-001, zgc:56310-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023444 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023444|OTTDARG00000019155|ZDB-GENE-040426-977 rpa3|OTTDARP00000019479 DKEY-119M17.3-001 LG_ BX927077.10 Danio rerio protein_coding KNOWN, 643 bp
GCCTTAAGTTTTCCCGCGGTTCTGGTGTTTGACTCGACTG
CTTGGCGTCTAGTCTTTTTGCGTGTTTTTTTCAGCTGTAG
TTTTTTCATAAACATCCACAATGACAGGCGTTTATGAGTC
TCCGAAAACCCGGATCAACACGTCGATGCTGTCTCAGTAT
ATCAGTCGACCAGTCTGCTTCGTTGGACGCTTGGAGAAGG
TACATCCATCAGGAAAGGTTTTTACACTGGTAGATGGTGA
AGGAAAGTCAGCGTCAGTGGAGCTCAATGAACCCCTGGAC
GAAGAGCTGAGTGGGATTGTGGAGATTATTGGAACGGTGT
CCAACAAAGGAGCAATCATGGCTACTTCGTATACTCAGTA
TCGAGAAGACAAAGTCCCGTTTGATTTGGAGCTGTACAAT
GAAGGTCTGAAAGTTCTTCATGATTTTCCTCAGCATTACC
CATTTGAAGTGTCAATGAGTGGTTAAACAACTGTCTTTTA
TTTCCCTTTTTACCTTGTTTTTGTATAATTGGATATTACT
GTTTCTGTAAATAAAACAATGAAAACAGTTTGTTTTGTTT
ATTATTATTATTTGAAAATTTTAACTATTATACAATTTTT
CAAATTATTTGGAAAATAAAAAACACTGCTGCATTACATA
AAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rpa3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000023444 (1),  Ensembl_Trans:ENSDART00000018553 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC071377 (1) 603 bp
GenBank:BI877328 (1) 539 bp
GenBank:BC046064 (1) 525 bp
GenBank:BI672819 (1) 515 bp
GenBank:BI673584 (1) 464 bp
CITATIONS (2)