Transcript

slc25a27-201

ID
ZDB-TSCRIPT-090929-649
Name
slc25a27-201
Previous Names
  • slc25a27-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006172 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006172|OTTDARG00000005668|ZDB-GENE-040426-1290 slc25a27|OTTDARP00000005489 slc25a27-001 LG_ BX248390.7 Danio rerio protein_coding KNOWN, 1472 bp
AAGGCGCATGCGTACAAAAATGACGGGCCGTCCTTACGCA
AGAAACTCGACTTATGACTGATGGTGCCAGTTTTGTGTGG
GGTAGTGTGGGAATTGTGGTTTTCTGTGCCCGACTGTTCT
TTTGTAGTTTATAACGTTGTACGTAATTACGTAAGGGGGT
CGGTAACTACACCGTCCAACCGGCTTGGCTTAAAAAGAAA
CGGGTTCGCCTCTTATTAAAGGTCGTAGTCCTGTCTTGAG
CTGTGTCAACACTTGAGCATGCTCTCCAGGCTCGTGGTTC
CTTTGGGACATAGTTAATTTCATGAATATATATTATATAT
TTTTTCATTTGGAAGTCAGAAGACACTTGTAATGTCTCAT
CTTCAAGAGAATTCGCGGTGGCCCCGAGTTTCAAAGTTCA
CTTTATCAGCCTGTGCTGCAGCTGTGGCAGAATTGGTCAC
ATTCCCCCTGGATCTTACCAAAACCAGACTCCAGATCCAG
GGTGAAGGCAGATCTGGAAAGAATGGTGGAAGCGTACAGA
CTCAGAAATACAGGGGCATGTTGAGCACAGCTGCAGGTAT
AGTGCGAGAAGAGGGGCCCTTGAAACTGTGGCAAGGGGTC
ACACCAGCTATCTACAGACATATAGTGTATTCAGGCGGCA
GGATGCTGGCCTACGAACAGATGAGGGAATCTGTCTTGGG
AAAATCTGAAGATGGCATTTTTCCAGTTTGGAAAGCAGTG
ATCGCCAGTATGATATCAGGTGCTTTGGGTCAGTTCATAG
CTAGTCCAACTGACCTAGTGAAAGTTCAGATGCAAATGGA
GGGCAGGCGACGACTAGAAGGGAAGCCGCCGAGGGTACGT
GGAGTTTATCATGCTTTTACAAAGATCGTCGCACAAGGAG
GAATACGAGGTCTTTGGGCCGGATGGGTTCCCAATGTTCA
GAGAGCCGCACTGGTCAATCTAGGAGATCTCATGACGTAC
GATACAGTGAAGCATTTTCTGCTGAGAAACACCTCCATAC
CGGACAACAGCATCTGTCATGGATTGTCAAGCATATGCTC
GGGATTGGTTGCTGCTACTATGGGAACACCGGCGGACGTG
GTGAAAACTAGAGTCATGAACCAGCCTCGGGATTCAAACG
GGAGGGGTCTTCTCTACAGAAATTCTACTGACTGTCTGCT
TCAGTCGGTCCGAAGAGAAGGATTTTTTTCTCTATATAAA
GGATTTCTTCCAACGTGGTTTAGAATGGCTCCCTGGTCTT
TGACTTTTTGGCTTACATTTGAGCAACTGAGACGAGCAAT
GGGAATCAGCTCATTTTAATGATTTTTTTGTGTTTTGTGT
TTGTTTAATTTGTATCTTTAAACCGTTACTTGCTGACATT
CCACTCTTTATTCAATTGTTGGGCACTAGTATGAGAAAAA
ATACTTTTTTACATCACTAGTATGAGAAAATACAAGGTTT
CTTGGATAAATAAAATATGTTACAGACCTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations