header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6353
Transcript Name: zgc:55461-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023179 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023179|OTTDARG00000018963|ZDB-GENE-040426-2879 zgc:55461|OTTDARP00000019296 DKEY-2N12.2-001 LG_ CR855258.6 Danio rerio protein_coding KNOWN, 1586 bp
GCGCAGAAGTTTGTCGACTCGGCACGCGGTGGAGGAGAGT
TCAGTTTACTACATTTGCTTTTTAAATACGCGACTTCTTT
TGATTATTCATCATGAGGGAAATTGTTCACCTGCAGGCTG
GTCAGTGCGGAAACCAAATCGGTGCCAAATTTTGGGAGGT
GATTAGTGATGAGCACGGAATTGACCCGACGGGAACTTAC
CATGGAGACAGTGATCTGCAGTTGGAGCGGATTAACGTCT
ACTACAACGAAGCCACTGGTGGAAAGTATGTGCCACGCGC
GGTTCTTGTCGACCTGGAGCCTGGAACTATGGATTCAGTG
AGATCTGGACCGTTTGGTCAGGTGTTCCGACCTGATAACT
TTGTCTTCGGTCAAAGTGGTGCTGGAAACAACTGGGCCAA
GGGTCACTACACTGAAGGTGCTGAACTTGTAGACTCTGTT
CTCGATGTGGTCCGTAAGGAGGCTGAAAGCTGTGACTGCC
TGCAGGGCTTCCAGCTCACACACTCCCTTGGAGGAGGCAC
CGGATCAGGCATGGGCACTCTCCTCATCAGCAAAATCCGT
GAGGAGTACCCAGACCGAATCATGAACACCTTCAGTGTTG
TGCCCTCACCAAAAGTCTCGGACACTGTTGTAGAACCTTA
CAACGCCACGCTGTCCGTCCATCAGCTGGTGGAGAACACT
GATGAAACGTACTGCATCGACAATGAGGCGTTGTATGACA
TTTGTTTCCGCACTCTCAAGCTCACTACACCCACCTATGG
TGATCTCAACCACCTCGTGTCTGCCACCATGAGTGGGGTC
ACCACCTGCCTTCGCTTTCCTGGCCAGCTCAACGCTGACC
TGCGCAAACTAGCCGTCAATATGGTGCCTTTCCCCCGTCT
GCATTTCTTCATGCCAGGGTTTGCCCCCCTCACCAGCCGA
GGGAGTCAGCAGTACCGGGCTCTTACAGTGCCAGAGCTCA
CCCAGCAGATGTTTGATGCCAAGAACATGATGGCAGCTTG
TGACCCACGCCATGGTCGCTACCTCACCGTCGCTGCTGTT
TTCCGAGGCCGCATGTCCATGAAGGAAGTGGATGAGCAGA
TGCTGAATGTCCAGAACAAGAACAGCAGCTATTTCGTGGA
GTGGATCCCCAACAACGTCAAGACTGCTGTGTGCGACATC
CCACCTCGCGGTCTCAAAATGGCAGCCACTTTCATCGGCA
ACAGCACTGCCATACAAGAGCTTTTCAAGCGAATCTCTGA
GCAGTTCACCGCTATGTTTAGGCGCAAGGCCTTCCTGCAT
TGGTACACAGGCGAAGGGATGGATGAGATGGAGTTCACTG
AGGCCGAGAGCAACATGAATGACCTGGTGTCCGAGTACCA
GCAGTACCAAGATGCCACTGCGGAAGAAGAGGGAGAGTTT
GAGGAAGAGGGAGAGGAGGAGCTTGCCTAAAGAATAGAGC
ACTCAAGTTCTGGTGCAGTGTTCTGTTCAATTTATTTGTT
TGTCATTTCGTTCCAATCCCTTTTTTTTTTTCACAAAAGC
AGTTTCACAAGCAGCTAAAATCAGTTACTGTACACAAATG
TCCAATAAAATCTATTCTTGATGGCT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:55461-001 Contained in:
OTHER zgc:55461-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023179 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC071414 (1) 1664bp
    GenBank:BC045346 (1) 1606bp
    GenBank:CN017506 (1) 954bp
    GenBank:CA496529 (1) 886bp
    GenBank:CK869241 (1) 846bp
    GenBank:CO814772 (1) 836bp
    GenBank:DN596942 (1) 775bp
    GenBank:BM530365 (1) 595bp
    CITATIONS (1)