Transcript

slc1a3a-002

ID
ZDB-TSCRIPT-090929-6330
Name
slc1a3a-002
Previous Names
  • slc1a3-002
Transcript Type
mRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Sequence
OTTDART00000023123 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023123|OTTDARG00000018920|ZDB-GENE-030131-2159 slc1a3a|OTTDARP00000019251 slc1a3a-002 LG_5 BX510907.15 Danio rerio protein_coding KNOWN, 823 bp
ACACACACTCTTCCCTTCCAAACTCCTGCAGTTTCTTTCT
AAGTACACACTTCTCTCTGCTCCCTCGGCGTGGAGGATCT
TCCCTGAACCAAATCCTGTATTTTTCTGATTGTCGGCGGT
GTGGCGTCTCCTCCAGACATGACTCAGAGTAACGGAGAGA
CGCGTCTGCAGCGCAGCAGAGTCCAGCAGCTGCGGGATGG
CCTGACCGAGCGCTCGCTGAGGGCCAAAAACACTGTCCAG
AACATCTCCAGCAATGACGTCAAGGGCTTCTTCATGAGGA
ACGCTTTCGTCATCCTCACCGTCGCTGCCGTCATCGTGGG
AATAATCCTGGGATTCGGACTGCGGCCGTATAAGATGTCG
TATCGGGAGGTGAAGTACTTCTCTTTCCCCGGAGAGCTGC
TGATGCGGATGCTGCAGATGCTGGTGCTCCCCCTGCTGGT
GTCCAGTTTAATCACAGGAATGGCAGCTCTGGACAGTCGA
GCTTCAGGGAAGATGGGAGTGAGAGCTGTGGTTTACTACA
CCACCACCACCATCATCGCCGTCTTTATCGGCATCGTCAT
GGTGCTCATCATCCACCCAGGAAAAGGCTCCAAAGACGAA
TTCACCAAACACGAGAAAATCGAACAAGTCAGTCCAGCAG
ACGCCTTCCTCGATCTCATCAGAAACATGTTTCCACCAAA
TCTGGTGCAAGCTTGTACACAACAGTTTAAGACGCAATAT
GGCAAGAGAGTGGTCACAGTCAAAGTCCTGGTGAACGACA
CAGTGTTCAGTCTGAATAACGGCACGCAGGAGCTCAAACG
GGAGGAGGTGATCCCGGTGCTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations