Transcript

slc1a3a-001

ID
ZDB-TSCRIPT-090929-6329
Name
slc1a3a-001
Previous Names
  • slc1a3-001
Transcript Type
mRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
None
RNA Central
None
Note
None
Sequence
OTTDART00000023122 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023122|OTTDARG00000018920|ZDB-GENE-030131-2159 slc1a3a|OTTDARP00000019250 slc1a3a-001 LG_5 BX510907.15 Danio rerio protein_coding KNOWN, 2101 bp
ACACACACTCTTCCCTTCCAAACTCCTGCAGTTTCTTTCT
AAGTACACACTTCTCTCTGCTCCCTCGGCGTGGAGGATCT
TCCCTGAACCAAATCCTGTATTTTTCTGATACCCGTGTGT
TGCTGTGTGCAGTGTCGGCGGTGTGGCGTCTCCTCCAGAC
ATGACTCAGAGTAACGGAGAGACGCGTCTGCAGCGCAGCA
GAGTCCAGCAGCTGCGGGATGGCCTGACCGAGCGCTCGCT
GAGGGCCAAAAACACTGTCCAGAACATCTCCAGCAATGAC
GTCAAGGGCTTCTTCATGAGGAACGCTTTCGTCATCCTCA
CCGTCGCTGCCGTCATCGTGGGAATAATCCTGGGATTCGG
ACTGCGGCCGTATAAGATGTCGTATCGGGAGGTGAAGTAC
TTCTCTTTCCCCGGAGAGCTGCTGATGCGGATGCTGCAGA
TGCTGGTGCTCCCCCTGCTGGTGTCCAGTTTAATCACAGG
AATGGCAGCTCTGGACAGTCGAGCTTCAGGGAAGATGGGA
GTGAGAGCTGTGGTTTACTACACCACCACCACCATCATCG
CCGTCTTTATCGGCATCGTCATGGTGCTCATCATCCACCC
AGGAAAAGGCTCCAAAGACGAATTCACCAAACACGAGAAA
ATCGAACAAGTCAGTCCAGCAGACGCCTTCCTCGATCTCA
TCAGAAACATGTTTCCACCAAATCTGGTGCAAGCTTGTAC
ACAACAGTTTAAGACGCAATATGGCAAGAGAGTGGTCACA
GTCAAAGTCCTGGTGAACGACACAGTGTTCAGTCTGAATA
ACGGCACGCAGGAGCTCAAACGGGAGGAGGTGATCCCGGT
GCTGGGGACTGTAAACGGGATAAATGCTCTGGGACTGGTG
GTTTTCTCCATGTGTTTTGGCCTGATCATCGGGAACATGA
AGGAACAGGGCCAGCCACTGAGGGATTTCTTTGACTGTCT
GAACGAGGCCATCATGAGGCTGGTGGCCATTATCATGTGG
TACGCTCCACTGGGTATAATGTTCCTGATTGCTGGAAAGA
TAGTGGAGATGGACGATCTGTCAGAAATGGGCGGTCAGCT
GGGCATGTACACCATTACAGTCATCATTGGCCTGCTGATT
CATGCTGTCATCGTACTGCCAATGCTCTACTTCCTTGTGA
CAAGAAAAAATCCATTCGTATTCATCGCTGGACTTTTGCA
AGCCCTGATCACTGCGCTTGGTACCTCCTCCAGTTCTGCC
ACTCTGCCCATCACCTTTAAGTGTCTAGAGGAAAATAACG
GTGTGGATAAGCGTGTGACCCGCTTCGTGCTGCCTGTCGG
TGCCACCATAAACATGGATGGCACTGCTCTGTATGAGGCT
CTGGCTGCCATTTTCATTGCACAGGTCAATGACATGGAGA
TGAACTTTGGAGAGATCCTAACCATCAGCATCACTGCAAC
AGCAGCCAGTATCGGTGCCGCTGGAATCCCTCAAGCTGGC
TTGGTTACCATGGTGATTGTGCTGACCTCTGTGGGACTGC
CCACTGATGACATCACTCTGATTATCGCTGTTGATTGGTT
TCTAGATCGACTCCGCACCACCACTAACGTTTTAGGAGAC
TCCATTGGCGCTGGCATAGTGGAGCATCTGTCACGTCACG
AGCTGCGCTCCATCGACGCGGAGATCGGAAACTCTGTGTT
GGAGGAGAACGAGACCAAGAAATCCTACCAGCTCATCTCT
CAGGAGAGCGAGAGCGACAATGCCAAGATCCCTGACAGCG
AGAGCAAAATGTAACTCCTGTTTCCTGAGGAGTTTCATTT
CCTGGAGGTTTTGTACAAACACTAGTGACTTAGTCAGACA
CTTCTAGTCTGATATTCATCTCAAGTTTTTTTATTATTCC
TCAAAGACATCCAAATGTGTGAAGTCCGAGCTGAGATGGA
CACGGGCGGTCCACTGTTTTCTTGTAGAGTAAATGGATTA
GTTTGGTAAAGATCTGATCGCGTTAGACGTGTTTTTATTA
ACTCTAGATGTCCAGGTTTGGTGTTATTAATTCAAAGCAT
GTCGTTGTGGAAACTGTTTGTTAAAAATGATGGCTCTACA
AAATAAATTGATTTTAAATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations