Transcript

hira-201

ID
ZDB-TSCRIPT-090929-6239
Name
hira-201
Previous Names
  • hira-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023017 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023017|OTTDARG00000018859|ZDB-GENE-030131-6296 hira|OTTDARP00000019185 CH211-188G24.3-001 LG_ CR774200.5 Danio rerio protein_coding NOVEL, 3811 bp
TTCATCCTTTGTTTCCAAGGGAACTTCGAGGAAGACGGCG
AACTTCCGGCGTGACTTCAGTTGCTGCAGCTTCACGCTCG
CGCTCACGGAGTGATGAGAGAGAGGGAGAGAGAGAGACGG
ACATGGAGTTCAACTGAGCAACAAAAGTAACGGAGGAGCC
GCAGCACTCGAAGAGCCGGGCGGACGCTGGAAATCAGTTT
CCTCGCGGGCGCGGAGGGAGATCGCGGCGTGCAGACGGCG
GATTTAAAACTGATCGGCGTAAAGATGAAGCTCTTGAAGC
CGAGTTGGGTCAATCACAATGGTAAACCAATATTCTCAGT
TGATATCCACCCAGATGGAACTAAGTTTGCTACAGGTGGC
CAAGGTGAGGACTCTGGGAAAGTGGTCATCTGGAATATGG
CCCCGGTTCTTCGAGAGGAGGATGAGAAGAACGAGAATAT
TCCCAAATTGCTTTGTCAGATGGACAATCACTTAGCATGT
GTGAATTGTGTGCGGTGGTCAAATAATGGCTTATACCTGG
CATCAGGAGGAGACGACAAACTGGTCATGGTGTGGAAGAG
AGCTGCTTTCATAGGTCCAAGCACGGTGTTTGGATCCAGC
AGTAAACTGGCTAATGTGGAACAGTGGAGGTGCGTCACGA
TTCTAAGGAACCACACGGGAGATGTAATGGATGTGGCCTG
GTCACCTCATGATGTCTGGCTCGCGTCCTGCAGTGTGGAT
AACACCATCGTTATATGGAACGCTCGGAAATTTCCAGAGA
TAGTGATGACTTTAAAGGGGCACACGGGGCTGGTGAAAGG
GCTGACGTGGGACCCTGTTGGAAAGTACATCGCCTCCCAG
GCAGACGACCATAGTCTGAAGGTCTGGAGAACCATGGACT
GGCAACTAGAGACGAACATCACAAAACCCTTCAGTGAATG
TGGTGGCACAACACACGTCCTGAGGCTGAGCTGGTCTCCT
GATGGTCAGTACCTGGTTTCAGCTCATGCCATGAATAATT
CTGGGCCCACAGCTCAAATCATCGAACGAGACGGCTGGAA
AACCAACATGGACTTTGTGGGTCATCGAAAAGCCGTTACT
GTTGTGAAGTTCAATCCTAAAATTTTTAAGAAGAAGCAGA
AAAATGGCAGCACACCCAAACCCAGCTGCCCGTACTGCTG
CTGTGCTGTGGGTAGTAAGGATCGCTCATTATCTGTATGG
CTCACCTCACTCAAGCGTCCTTTGGTGGTCATCCATGACC
TATTTGACAAATCCATAATGGATATTACATGGACACTGAA
TGGACTGGGACTCCTGGTGTGCTCCATGGATGGAACTGTG
GCCTTCCTGGACTTCTCGCAGGATGAACTGGGAGACCCCT
TGAATGAAGAGGAAAAGAATGCCATTCATCAAAACATCTA
TGGAAAGAGTCTGGCCATCACAATGGAGTCACAGCTTTCC
ACCACAATCATTGAAAACCCTGAAATGCTAAAGTATCAGC
AGGAAAGACAGGGAAACCAGAACGCTAATGTAGCCCAGGG
AAGCGGCCCTGAAAACCAGACGCCCAAACTCACTAATGTG
CTCAACGGAGAGTCCCTGGAGGACATCAGGAAGAACCTCT
TAAAAAAGCAGGTGGAGACCAGAACAGCAGACGGGAGAAG
AAGAATCACACCTCTCTGCATCGCACAGCTCGACACAGGG
GACTTCTCACCAGCATTGTTTAACAGCGTTCCGATCTTGC
CGGGGTCATCCGCATCTACCCAGCTCACCCCACAGATCTC
TTCTGATTCCAACACGGCCAACTCACTGGGCCTACGACCC
TCTCATGACCCCAGCACCACCTCTCCAAACAAAACTGCAG
AAGAGAACAAGGACAGTGCAACAGCACCTGTAAACTCCAT
TGGTATGAAATCAACTCTGCTGCTGACTTCTGCCTCCAAA
ATCGAGCCCATGAAAGCACTAGATTCACGATTTACTGAAA
GGTCAAAAGCCACACCAGGGGTCACTAGCGTACCCATCAC
CATAGGCATCACGCCACTTGACAGGGCAAAAGACAGCAGC
TCTGTGAAGGAGCCGAAAGGAAAAGATGAAACCAGCAGCG
ACAGCGAGGACAAGATCATGAACAAAACACTGTCTATGGC
CAAGAGGAAGGGAGAGATTGAGGGAGGAGAGGTGGTGGAG
AAGAGGAAGAAGGGAAGGCCGAGGAAAGATGCCAAAATGA
TGATGCCCATATCACAGCCTTTCCCGCAGACTCCAGTCTC
AGTGAAGGAGGAGCTGCCTCGATTAGCAACACCTGCAGTG
GTGTTAAAACTTCCAACCCCATCCATACAGAAATCATTCA
GCACTCAGGTGGGCACTGATGCCGTCACGTATCTGGAGGT
GGAGAATGAGGTCTCGGTGGTGTCTGGAGCTCGTCTCAGT
CAGCTCAAATGGAGGAGAGAGGGCAGAGAGTGGGACACAC
TGCTGCCCAGTCGAATAATCATAGCAACGGGGAGCAGTGA
TGTGGTTGCGGTAGCGTGCGAAGACCGAACTCTCTCTGTC
TTCACTGCCTGTGGACGGAGGCTGATTCCCTCCATCATGC
TGCCGGCACCCATGTCAGCACTTCATTGCTCGGGTCACTT
CGTCATGGCACTGATGGCATCAGCCACGCTGTCTGTCTGG
GATGTTCAGAAACAGACGGCTCTGGTCAAAAATGAATCTC
TGAATCCAATCCTATCAGGCACAGACGCAACAGTAAGCCA
GTCTCTTATAACGCAGCAAGGTGTAGCAGTGGTTTCGTTG
TCAAATGGAAAAACGTACTGCTTCAATTCATCACTAGAGA
CCTGGAATTTGATTGCCGATAAGCAGGACTCTCTGGTCCA
GTGTGCAGATTTCCGCAACTGCTTGTCCTCTCAGGATGTT
TTGGGCTCCATGGGGCCCCTGGCTCTCACACAGGGACGTA
ATCTGAGCGCTGGGCGGTTGGCATCTCGCTTGTCATCGAC
TCCTCATCACTTGCAGCAGGGAATGACTCTGGCCTTCTTG
GAGAACCAGCTCTCCTCCGCCCTCATGCTCCTTTCAGCGA
GCGAGTACAGACACTGGCTTCTTATCTACGCACGCTTTCT
TGTAAACGAGGGTTATGAGCATAGGTTAAGAGAACTGTGT
CAGGATTTACTGGGACCGGTTCACAAATCCAGTAGCAGCT
CCTGGGAGTCCACAGTCCTGGGTCTGAGAAAGCGGGATCT
GTTGACCGAGGTGCTGCCTGTGATTGGTCAGAACTTGCGT
TTCCAGAGACTTTTTACAGAGTACCAGGATCAGCTCGAAT
TACTGCGTCTGAAATAGCACTTGACCGTTTGATGTTTCAC
CCCGACCCCTTCCTGGCCTGTACATGTGCTAACAGTCTGA
CAGCACTGTCTATACCGCAGACACGGACACTAATGAAATG
GACAAAAATAATGATGCTCTTTTTCTTTTCTTCCTTTTTT
TTTCAAAGAATTAATTTGTTAAATACAGTTATTAATTATG
TTTGTAAAGTGGTAAGAAAAAAAGAAAGGATGGGTTCCCT
TGGGATCTTTTTGATCAAGCACAAAGCTTGCGTGGCAGGA
CTCTCGAAAACTGGACGGTTTTTACTTCTGAACTAAAAGC
TGATGTAAATTTAGTGATCCGACTCTCCCTCCCTCCTTTC
TTTTTGTCTTTCTCCTTCAGTTCTTATTTGTACAGCCATT
TGTCATTTATTTGTAAATGTTTGTAAAAGGCGATTTTGTT
TGTTTTTTTGTTTTTTCCCCCTCCATTTTCTATAAAATAA
GGAAAATGGTAAACCTTCAATTAAAAAAGGAATAAACAAT
TTACCAGTTCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations