Transcript

borcs7-201

ID
ZDB-TSCRIPT-090929-6178
Name
borcs7-201
Previous Names
  • borcs7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022954 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022954|OTTDARG00000018825|ZDB-GENE-050913-112 borcs7|OTTDARP00000019142 CH211-67N3.3-001 LG_ AL928951.17 Danio rerio protein_coding KNOWN, 754 bp
AAACAGTAATGGCTTCCTCCGAAACGCAGCCCCGCTTCGG
TCAATCTGTCAAAGGTTTATTGTCTGATAAAGTAACTTCT
TGCAGTGGAGATGTGATCGCTTTAACTCGTCAAGTGTTAA
AAGGATCCCGGAGCCAAGAACTACTCAGTCAGGCAGCGAG
AAATATGGTCATTCAGGAAGATGCCATTCTCCATTCCGAA
GATAGTCTACGGAAAATGTCTATTATAACGACCCACTTGC
AGTACCAGCAAGAGGCCATTCAGAAGAATGTTGAACACTC
GAAAAACCTGCAGGATCAACTGAGACACTTGATGAAATAA
TACTGCTCTTCTAATATACAAATGTAGCCTCCTATAATTT
CTCTCTCTCTTTTTTTTTTTTTACTGTAAATCAGTTGCAG
GTGATTACTCATTGCACACATTGAAAGACATTCCAACATC
CTCCTTTTCTCTTGAAATGCATTAGATTTTCAAATGAAGG
CTTTTCTGTTGGAGATTGTTTTCAGTATTAATATTCGAAA
TGATAGTCAAATTAACGTCCACCACTTCTGTTTGTTTGAC
TTGGTACATTTGCTTTTAGACTTTTAAATCAGGTTTACAA
ATTAGAAATTGTTAGTCTATTTATATCTTGTTTTATATGG
TGTAATTGTTTTGCCAAACATACTTGAACATATTTGTATA
AAATGTTACACAGCATTGTTTCAGCACATTTTGCTAAGCA
GCTTTAATAAATGGATGTGGAAAGTTGGATGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations