Transcript

clip1a-202

ID
ZDB-TSCRIPT-090929-6147
Name
clip1a-202
Previous Names
  • clip1-001
  • clip1a-001
  • si:dkey-273o13.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022922 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022922|OTTDARG00000018803|ZDB-GENE-060526-282 clip1a|OTTDARP00000019119 DKEY-273O13.1-001 LG_ BX897741.9 Danio rerio protein_coding NOVEL, 1366 bp
CCACAAAGACAGCAACATTATACTAAATCTCAAAAAGGAG
TGTGACCGTCTAAATGAACAACTGAAGGAGGCGAAAACAA
GGGAAAGCAGTTTCAGAAGTGAATCTGAAAAGGAGAAAGC
AGCACTTCAGCAGACACTACAGACGCAGAGCGGCTTGGTC
TCAGAAAAGGACAAGGAATTAAACTCTCTGAGAAATGAGC
TGGATGCTCTAAAACAGCAGAACTCTCAGTATCAGGAGAG
TTTGAGTTCTGACAGTGAGAGAATTAACAGCCTCAGTAAA
GAGATTGAGGAGTTGAAACAAGCCGCTGTCGAGAAATCCC
AGGCAGTGGACGATCTGAAAAATGAGAAGGAAAAGCTAAC
CATGGATCTCGCCAACAGCCTCAAAGACAGCAACATACTG
CTAAATCTCAAAAAGGAGTGTGATAACCTCAACGATCAGC
TGAAGGAGTTGAAGAAGAGGGAAAGCACTTTAACAAGTGA
ATCCGAAAAGGAGAAAGCAGCGCTTCAGCAATCTCTTCAA
ACCCAGAGTGCCTTGATCTCAGAAAAGGACAAAGAGCTAG
ACTCCGTGAGAAACGAGCTCAAAAAGGAGCGTGACAGCCT
CAACAGTCAGTTGAAGAAGATGGAAATGAGGGAAAGCACT
TTAACGAAAGAAACGGAAAAGGAGAAAGCAGCACTTCAGC
AATCTCTTCAAACCCAGAGTGCCTTGATCTCAGAAAAGGA
CAAAGAGCTAGACTCTATGAGAAACGAGATGGGTGGTCTG
CGGGATCAGACACAGACGCTGCAGTCCAGTCTCAAATCTC
AAAAGAGTGAGAATATTCAGCTTCAGGAGCGACTGAAGGG
TCTGGAGAGGAGTTTAGCCGACGCTCAGATCCCCAGCAAA
GGAGATAACGCCTCAGATGATTCTGCCTTAAGAATGTGGA
AGGAGGCAAAGGAGAATGCCGAGCATCAGGTTGAGTTCCT
GAACTCGGTCATTGTGGAACTGCAACGGAAGAATGAAGAC
CTAAAATCTAAGCTAGAGAAGATGGCCGAAGCAGCGCTCA
ATGGAAACGGTGCAGCTGAAATGGACAGCCGTAACAACAG
TCACACCGAGCCGGCGATTAAAAAGAAGCCTCCTCCCCGT
CTCTTCTGTGACATTTGCGACTGCTTTGACCTGCACGACA
CTGAAGACTGTCCCACCCAGGACCAGATGGAGGATTCCCC
GCCGCACACCACCTACCACGGCAGTCCCAATGACGAAAGA
CCATACTGCGACATCTGTGAGGTGTTCGGCCACTGGACAG
ACTCCTGCAACGACGATCAAACTTTCTAGGGTCGCTTCCA
TGATCCCGCAGCATTTACACATGCAATACTATGCCTTGAA
TCAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations