Transcript

apba1a-202

ID
ZDB-TSCRIPT-090929-6085
Name
apba1a-202
Previous Names
  • apba1a-002
  • si:ch211-62b4.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022851 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022851|OTTDARG00000018765|ZDB-GENE-060526-175 apba1a|OTTDARP00000019085 CH211-62B4.1-002 LG_none BX470086.9,BX942831.17 Danio rerio protein_coding NOVEL, 757 bp
ATCAACGTGAGTTTAATGAGAGAGCAAGACGCTTGTCTGT
TCTCTTCTCTCATCCTCTGGTTCAAAGAGCAACACTTGCT
GTAAACACTTGATTTGAGTGGATCGTGAGGAAGAACATTT
TTCACTGCAGCTTTTGATATGGAAAATTTCTGGATGTATC
AGGTAGATTGTCAGCATGGTGATGAGTCTCCAGGATCAGG
CTCCACCTCCCCTCAAGGGGCAGAATCATCCAGCCATCAA
ATGATGTCACAGGAGGGGAGTGACAGCTTTGAGTCTCCAT
CTCCAGCTGGTAAAGAGTCAAGAAGAAGTCTTGCTTCATT
CCCAACATATGTGGAAGTACCAGGGCCGTGTGACCCAGAG
GACCTTATTGATGGTATTATCTTTGCTGCTAACTACCTGG
GATCCACCCAGCTGCTCTCAGACAAGACACCCTCCAAAAA
TGTGCGCATGATGCAGGCTCAGGAAGCTGTGAGTCGCATT
AAGGCTCCAGAAGGCGATGCTCAGCCCATGACGGAGGTGG
ACCTCTTCATTTCTACTCAGAGAATCAAAGTGCTCAATGC
AGACTCACAGGAGACCATGATGGATCACCCTTTAAGGACC
ATCTCCTATATTGCTGATATTGGGAACATTGTGGTGCTGA
TGGCCAGAAGGAGAATGCCTCGCTCTGACTCTCAGGAGAA
CATGGAGGCCTCTGATCCAGCCCAGGATGAGAAGCGCCAA
TACAAGATGATCTGTCACGTCTTTGAGTCTGAAGATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations