ZFIN ID: ZDB-TSCRIPT-090929-6062
Transcript Name: rsph4a-201
Previous Name: rsph4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022817 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022817|OTTDARG00000018747|ZDB-GENE-030131-7437 rsph4a|OTTDARP00000019063 DKEYP-117B8.2-001 LG_ CR759879.17 Danio rerio protein_coding NOVEL, 1775 bp
GTTTGTTGTAGTTACACAGCAACGGAAGTGCGCTGTGGAA
ATGCACTGCTGCTTTTGCAGAACTTTTTTGCGTTAATGGA
GGTTTAAGTTAGTGCGAAGAAGAAGAACACAGACTGACAT
ATTTACATCAGTCGGCGATATTTTGTAAGCATTTCCATCA
TGGAGATTACAGGTGAAGCGCTCAATAATAACAGACTGCA
GACCGCGGCCAGTTTTAAGGCGTTCATGATGAAGAACAGC
ACTAAAACCAACTTAAATCTCTATGACCACCTCGTACGGC
TGTTAACCAGAGTTATGGATGAGCGTCCAGAGAACGCAGT
TGATGTGATGGAAGACATGAGTCTGGAGCTGAAAGGAAGT
GTTCTTCAGGAGAAGCAGGACACTTTGCGCGACAGTCCAT
CCTCATCCCCAGCTCTGGTTCTGGCCGAGCAGCAGAAGAC
GCTCTTCATGCACACGGCAGGAGATGGAGGAGATCATGAG
GAGGAGCTGGTAGATTCTCCTTTACCCAATGTTGCAGAAC
TTGCGTTTTTCTTTGAGCAAGCTGGCGTGGGTCTGGGGAG
AGAGGAGATTCAGAGAATCTTTCTGGCTTTGAAACATCTG
GTAGACACACAGCTGCTCTTGCGGTGTCGATTCTGGGGCA
AGATCCTTGGGACACAGGGAAACTACCTGGTGGCGGAAGG
GGAATTCAGAGAAGGGGAAGGAGAGGAAGACGAGGGGACA
GAACAAACTCCAGAGGAGGACGAGAGAGAGGAAGAGCTGC
AGGAGGGCAAGGATGAAGCAGAGCTTGTGGAGGCTGCTGA
TCCGCTGCCCAAATCCACTTACAAGCCATCTGCATCAGTG
CCAAAAGAAGGAAATCACACCGGCGCCAATAAATTCACCT
ATTTTGTGTGTCAAGAGCCTGGTATGCCGTGGGTCAGACT
GCCGGTGGTCACTCCAGTGCAGATTACAGTAGCGCGGCAG
ATCCGCAGGTTCTTCACAGGCAAGCTTGATGCTCCTGTTG
TGAGTTACCCTCCTTTTCCAGGCAATGAGGCCAATTATCT
GCGTGCCCAGATCGCACGAATCTCGGCGGGAACCCATGTT
AGTCCTCTGGGATTCTATCAGTTTGGAGAGGATGAAGGTG
AGGACGATGGCCTGCGAGACAGCTTTGAGGAGAACCCTAC
CTTTGAGGGCATCCAAGTAAATGAGATGGCTGAGTCTCTG
AATCTATGGGTCCATCATGTACAGCATATACTTACACAGG
GCCGCTGTGTATGGGTCAACGTAACTAAGAAGCCTGTGGA
TGATGTTGACGAAGATGCCGAGGATGAAGAACGAGAGGAA
GAACCTGATGAACTAGAGCCTGAAGTCGGGCCTCCTCTTC
TGACGCCTCTATCTGAAGATGCAAAGCTCAATGACACTCC
ACCTTGGAGCTCAATGATGTCCTCAAACATCATTCCTCAG
TTTGCCATCGCTGTGCTTCGCTCCAATCTTTGGCCTGGAG
CTTATGCTTACTGTAGTGGCAAGAATTTTGGAAACATATA
CATTGGATGGGGGCTGAAATTTATCGGAGAACCCTTCACC
CCAGTGTTGCCTCCACCACCCCAAAGCGAGTTCCCCAGCG
GGCCAGAAACCACAGAGGCTTTGGACCCCAGTGTGGAGGA
AGAACAGGCTTTAAAAGCTGCAATGGAGGAGCAGACGGCG
GCTATGGAGGAAACTGAGGATCTGGAGGAAGAGGAGGATG
AAGATGATGATTAAAATGGAGGAGTACACAAAAATAAACC
TAGAGGTTGGTCAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rsph4a-201 Contained in:
[BAC] DKEYP-117B8 (1)

Genome Resources: Vega_Trans:OTTDART00000022817 (1),  Ensembl_Trans:ENSDART00000097340 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN023406 (1) 942 nt
GenBank:CN017961 (1) 939 nt
GenBank:CN020100 (1) 931 nt
GenBank:CO958305 (1) 869 nt
GenBank:AW184664 (1) 697 nt
GenBank:BQ783748 (1) 649 nt
GenBank:BQ073977 (1) 597 nt
GenBank:BQ075053 (1) 565 nt
GenBank:AW232300 (1) 430 nt
GenBank:BQ617608 (1) 420 nt
CITATIONS (2)