ZFIN ID: ZDB-TSCRIPT-090929-6061
Transcript Name: si:dkeyp-117b8.4-201
Previous Name: si:dkeyp-117b8.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022816 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022816|OTTDARG00000018746|ZDB-GENE-060526-362 si:dkeyp-117b8.4|OTTDARP00000047219 DKEYP-117B8.4-001 LG_none CR759879.17,BX511157.10 Danio rerio protein_coding NOVEL, 3976 bp
GTTTGCACGACGTCAAGCACATCCAGTTTGCAGGTCGTGT
TCGCGCGGATGATGTGCAGGAATTCTGAGATTTGTACTAA
TTAGATATTGCTCATTCGGGTTTGTATTTTACTAAATGAA
AATAAGTATTGAGAGTCAGTATCGCCGAAGTATGCACTGT
TTAGTGGAGACAACACGCGGACTGGAAGTGGATGAATCCT
TAATGGCCCCTATGCTCGCCCGGAAGAACATCCCGTGACG
CTTGATACATGGATCTCCCTCCCCCAAGGCATCCTGGTAT
TCACAGCAGTCCAATTCTTCGCAGGAGAATGCAGCGTTTC
TTGCCATTTTCCGATCGCCGCACGTCAAAAGTGTGGAACC
ACTACACTCAGCTAAGTCTGCATCGTGTCGAGTGCAACCA
TTGTAAGAGACAGCTTTCCTTTCACAACAGCACTACGTCT
ATGAGAGAACACTTGGGACGCAAACACAGCATTCGGGAAG
GAGTGGTACCCCCTCACAACACCGCAGGGATCCCCACTCC
TGGAGCATTACATTCTCACATTCAGTCCACTTTACATGGT
AACAGATGTAACAATACAGGCAACGTCACATTTCAACCAT
TGCTGCCTGTTACCGTCAAAGAAGAGCATGAAGAAATACT
GCCAGCTGAGATGGGAGAGGCCAAAGCTGCCCGGACATCA
TATGCCCCTGACTGTGCACCAGGAAGCAGTACATCTGGTT
CAAATGCAATTACACACCAGGATACAGATATGGGCTGTCT
AATGTATAATTTTCCTGCAGGGGAGATGAGCAGCACTGCT
GGAGGCAGCAGCAGTCGCTGTGGGACAAGAGCCTGCAGTA
ACAAGCGAGCAGAAGTGTTGACCGACCTTATTTTGGAAAT
GGTCTTTAGAGACCTTCAGCCATTGTCTGTGGTGGAGGAG
AGAGGGTTCAAGCTTTTACTGAGTTGCCTAGAGCCTAATT
ACCCCGTGCCTTCACCATCTCTACTTGGCAGCTTACTTTG
GCATCGCTACCACGTCCTCAAGCAATGCCTTCAGCAGCAT
CTTCAGACAAGTTTGGCTTCCCACTATATGACCCTTTGCA
CTGAATACTGGCGATCTGTAGAAGGATGTGGGGTTGGCGG
GGATGGACAGTACTACCTCTCAGTCAGTGCCCATTTTATA
GACTCTCAGTGGCGTCTGGCACGCTGCATGCTTGAGACCA
GACCGATAGCAGAACTCAAAGGAAACCCATCTGAGAGAGG
GCAAGTAAGTTTTGCAGATACCTTGAAAGCAGTCCTCTCT
GAGTTCCAGCTTTCAGAGAACTCTGTTTTCTGTGTGATGC
ACGACACCCCCAGTGACTCTGAGTCCAGGCAGAGTATCGA
TCGGGAATTTCCGCAGGAATTTCCTGGACCCAGCCATCCT
CCTCCCAGAAAACTTCCGAAGGGTTGGGCACCCCTGCTTT
GTGCAGGGCAGGCCCTAAAACTCTGTGTCCAGGAGGGACT
TTGTGTGGAGTCTGTAAGACAAGCTTTGGCAGATGCTCGT
GCCATCGTCCTGCACTTCCAACACAATGTGGGCGCTTCTA
CAGCACTGAGCCAGAAAGCAGAGGCTGTTAACAAAGAGTC
AGCATCCCTGGTCTTAAATGACCCGGGGCGCTGGACCACC
GCCATCGATATGTGTGAAAGTTTGCTGGAGCTCAAGTGGG
TAATAAGCTCAGTCTTAGAGGAACAAAAAATAGCAACAAA
TCTGGCAGATCACCAGTGGCGCCTCGTACACGAACTGGTC
CCTGTGCTAAAAACAGTTCGTATTGCAGCATCGTTTTTGA
GCGAGGACATCAACGGACCCATTTCAGCCCTAATGCCGTG
CCTCCAGGGAGTTTCCCGGCTCCTGGGACAGAAAATTGCA
GACTGCACCTGTCCAGTGGTGAGAGGAGTTATGGAGAGGA
TTCGTGCTGGTATGGACAAACGCTGGAGTCTGAGCGACGA
AGATGCTCTTCTGGACTGTCCTGCTGTGTTGTCTTCATTT
CTGGACCCACGTTTTAAAGAGTTGCGGTTCCTCAGTCCAC
ATGCTCGCAGCAAGCTGCATGACAAGGTTAAGGAGCTCCT
TTCTGTTCAGGCTTTCACAAGCAACGAGGGATTGAATGAA
GACAGAAGACAAAGGATGGAAATGGAAGAGGCTTTGGATG
AGCACGGAGATCCTGCAGATTTCGGATTGGATGATTCCTT
GCCAATTCCTCCAATGGGGTCTTTGGATTCTCCTGAATCG
TGCGGCTCACTGGAGGAAGGTGACAGTGTGGAGCTGCAGC
CAAGCGAGCTCTCAGTTGCAGTATCATCACCAGAACAGGT
CAATGACAATGCTCTAGAGGTTGGATCACCTTTTAAAAAC
ACCAATGAACGTAAAAGACGTTCCAGTGGGGCCACTATGA
CCTCCCCAGTGAGAGGAGATTTGCAGCTCACATCTCGGAT
ACGAATGAGTCCTCTCCCACAAAGCATGTATGATATTCTT
CTGGGTGAAGACCCTACTGAGCGAATGCCTGAGATTCACC
AACAGCTGGAAAATTATATAGCGGAGCCTCTGTGCAGACG
CAGCCTCTCGCCTCTGCAGTGGTGGCGCAGCAAGGAGCAT
CGGTTTCCAGCTGTGGCCAGACTGGCACGAAAGTACCTGT
CCATTCCAGCAACTGCTGTTTCCGCCAATCGGGCCTTTGC
CCCAAGGGAGTCTCCAGTTACGCAAAGAAGAGCCACTCTA
GGATCTAAACACCTGAACCATATTTTGTTTCTCCATCAGA
ACGCTGATTATCTGGACCAGCTGAAAGGGGGCTCCTCTGC
CCGTGAAATTGACCAGTGGAATAGTGTCAGTGGAAACCAA
AGCAGAGAAAGTCTTTACCAGACTCTAGTGTCATATGAAA
GTAAGGTCCGTGTTCCCGAGGAAGAGTCATGATCACTGAT
TTTGTAAAATTTGCATTTGTGTACTTTAATCACATCCCAA
AATAAGTCTGTTTATCAAGTTATTTGATGATTTTAATCGT
CTGTAGAATTTAGAAGCAAGGATTACGAGAGAAGAATACT
TGAACTGCTATTTAAAAGGTTTCCTTGTCATTCCTTGTAC
CAAGAATTTGTGACACTATGATTTAAAACCATCTTTGATC
TCTAAGAGGTCTGAGGGTTTTACTAAACTGGTTTTTACTA
TGTATTATCCAATTACGCAATCTGCGTGCATTACTAAACA
TGCTGCTAGTTTGGATAAATTATTATAATTTTTTTTGCAT
CATTCATACACTTCAGAGCTCCACAAATTTGGCCAATCAG
ATTCCAGTCCAGGTAGTAACTGTTGTATTAGTGACTAATA
AGTGTTTTTATTTTAAACAAAGTCTGTTACTTCAATGCTA
TTGTCACTTTACAGTGTTAGTGTAAGCATTACATGAATTC
ATTGTTAACCTCATGCTTGAATTTTTATCTTTGTCCACCA
TTTCGAAGGATATGTACATGAGGTATTCACTATTTTTTTT
CATACCTGCGACAGTAGAATTTACATTGTATTCTCTCAGT
AGCATGTTTAGGTTAAAGTTGTATGAAATATTAATGGGAA
TTGCAAATATAAATGGTTTTTCAGTTCTCATTTTTTAACA
AGCTTTAACAACAATACTACAGTGAAACATTTGTGCCATT
AAAGGGTACTAATGAAAGCAAACACCCGATAGTAAAATAA
CATTTATTTGATAACCTTAAGTCACACACATTTTAGATAA
TTTCGAACAAACTGGAAAACTTGTGACTTAAACTAGCTTG
GTAATGAATTAAAGTTTGTGCACTACAATTATTTAAACAT
AACATTTACTTCAAGAAAGTAATAGCAAGTATGAATTGTT
GCTTCAATCTGAACTGAGAGAAAATACTGAACTGAAAATA
TCCGAACTCAAAAATCTCTTAAAAGGTGAACAAACAAAAA
TGTTATATTTGCATGACTGTTCGCCTTTCTAGACTCACTA
TAGGGTTGTATGATAC

si:dkeyp-117b8.4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkeyp-117b8.4-201 3976
si:dkeyp-117b8.4-202 (1)    Ensembl 3997
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-117b8.4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000022816 (1),  Ensembl_Trans:ENSDART00000134344 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW077662 (1) 528 nt
GenBank:AI416315 (1) 386 nt
CITATIONS (2)