ZFIN ID: ZDB-TSCRIPT-090929-6035
Transcript Name: si:dkey-261j4.3-201
Previous Name: si:dkey-261j4.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022774 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022774|OTTDARG00000018714|ZDB-GENE-060531-124 si:dkey-261j4.3|OTTDARP00000019032 DKEY-261J4.3-001 LG_ AL935280.12 Danio rerio protein_coding NOVEL, 1878 bp
TGTGAAGAAACGAGTATCAGTAGGATGCAGACGGTTGATT
GTGCAGGCATTGCAAAACTTCACCCTAACCGACTCACTCA
AAACGCAGAATCATCAGGAAGGAACTGCTGTGTGTTGCTC
AGAGATCCACAACAGACAATTTTGCATCTAAAATAACTAC
CACTCAACGATCCCAATTCACACTTGGAAATAGAGAAAAG
CGTGAAGATGAAGAATACAACAAAACCCTGCAGAACAGAG
CATCACAATGCTGAAGGACAAAGAGATCGCATGGAGGGAA
ACAAGAAAGGAGAAACAAAGGCCAAAAAATCAGTCAGGAA
GAAAATCAGTGGGAAGAGTTTCCGAAGCAAAGGTGATGTA
AAGAAACACATGCTCATCCACACCGGAGAGAAGCCGTATC
GATGTGATCAATGTGGGAAATTTTTCCCATACAAACAAAG
GTTTAAACTACACCTGGAAGCCCATGCCAAGGGGAATCCA
TACAAGTGTGATGAGTGCGGGGAGAGTTTCAAAACCAGGT
TACAATTGAGGAGCCACATGACACTCCACCCTGAATACAA
GCCGTACAAATGTGATCAATGCGAGAAGAGTTACGGGAGA
GAAGACCACCTTCAGAGACACATGAAGCTTCACACAGGGG
AAAAGCCGCACAAGTGCGAACACTGCGGAAAGAGTTTCCC
GATGAGAGATTTGCTTAGGAGCCACTTAATGGTGCACAGC
GAAGTGAAGCCGTACACATGTGATCAATGCGGAAAGGGTT
TTACACTCAAAAAACGCTATAATGAACACATGAATATTCA
CACTGGAGAGAGGCCGTACACATGCGATCAATGCGGGAAG
GGTTTCCCTTATGAACAGAGTCTTAATCTGCACATGAGAT
TTCACCGAGGAGAAAAACCCTTCACTTGTGATCAATGCGG
CCAGAGCTTCTCCCAGAAAGGAGGCTATAACATCCACATG
AAAATCCACACTGGAGAAAAGTCGTATACCTGCGATCAGT
GCGGGATGAGTTTCAGACATGGATCCTCTCTCAAATTACA
TATGACGCACCATACTGGAGAAAAACCATTTCACTGTGAT
CAATGTGATAAATGTTATAGTACGGCATTATTCCTGAAGA
ACCACATAAAAACTCATGATAAGGCTCAAATTTACTCATG
CTTTACTTGTGGAAAGACTTTTAATCAATTGAGGGGTTTG
AGGTTGCATGAGAAAAGGCACAGCCTTACAAAGCCTTTTA
TGTGCTTTGATTGCGGAAAGTGCTACTTTACAGATACTGA
GCTGAAACAGCATCTGCCAGTTCACTCTAATGAAAGACCT
TACATGTGTTCACTCTGTTATAAGAGTTTCCCCAGAATGG
GAAGCTTGATAGTTCATGAGAAGACCCATAATGGAGAGAA
ACCCGATTGCCGCACTGGAAGTAAAAAGAGCCAGGATGAG
TGAGAACATAATGAAACATCTTTATTAAATATGTTTGCTT
TTTGATGTAAACTTTATCATGAAGCTTGTTTGTTTTCAGG
TCAGGTATTCTGTGACACTATTACTCGGGGATAGTTTATA
GTCTTTTATTGAAGTAGTTGTTTACAAAATGTTCTTTTCA
ATTAACTTTGTAACTTGCTAACAATTATATTCTTTTTCTT
TTAACTTTTAAATGTTATGAATCTTTCTCAATTGCTTTAA
CTGTTTTTTTATAGGCTTAAATATTAACTTTAGCTTATAT
ATTCTGTTTAGTATATATTGAATTCCATCTTTTTGTGCTT
TTTAAAAATTCAACATTAAGAATTTTACAGCAACAACTTG
ATAATGCCAGTCAATAACAGTTTAAGAAATGCATCTAACT
TGTATCTCAGAAAAAGAATAAAGTTCTTAAACACCTAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-261j4.3-201 Contained in:
[BAC] DKEY-261J4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000022774 (1),  Ensembl_Trans:ENSDART00000134314 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC095019 (1) 1896 bp
GenBank:AF157109 (1) 1848 bp
GenBank:BQ169347 (1) 1848 bp
GenBank:CN506609 (1) 809 bp
GenBank:CN022299 (1) 763 bp
CITATIONS (2)