Transcript

cyp2n13-201

ID
ZDB-TSCRIPT-090929-600
Name
cyp2n13-201
Previous Names
  • cyp2j30-001
  • cyp2n13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000005997 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000005997|OTTDARG00000040554|ZDB-GENE-041001-158 cyp2n13|OTTDARP00000005366 cyp2n13-001 LG_ BX322665.5 Danio rerio protein_coding KNOWN, 1827 bp
GATGAAGATATTACATAACTCACAGTTCACAACATTACAG
CTATGGAGCCAAATGTGAGGGGAGTGTCAGGCTGAACAGA
TGGATAAAGACAGCCTGTTCAACAAATTCTGCTAGGCTCA
CGTGGTCTGTCTTCATTCACATGCAGTCATGGCGTATACT
GCAATACTCGAGACTCTTGATGTGAAGGGAATATTGCTGT
TCATGGTGGCTTTTCTTTTGGTGGCAGATTACCTGAAGAA
CAGAAACCCACCGAAATACCCACCCAGCCCTTTCTCTGTT
CCACTACTAGGAAACATCTTCAACGTTGACTCCAAAGAGC
CTCATTTATATCTGACAAAGCTCGGCCATGCCTACAACAA
TATCTTCAGTCTTCGATTAGGAAGTGACAAAACCGTCTTC
ATTACTGGTTATAAAATGGTAAAGGAGGCCCTGGTGACAC
AAGCTGAAAACTTTGTGGATCGGCCCAACAGTCCAGTGCT
AGCACGTGTGTATTCTGGAAATGCTGGACTCTTCTTCAGT
AATGGTGAGATGTGGAAGAAGCAACGACGCTTCGCTCTGT
CAACACTGAGGAACTTTGGATTGGGAAAGAAAACAATGGA
GCTGGCCATCTGTGAGGAGAGCCGCTTTCTTCTGGAAGAG
ATAGACGAACAGAAAGGAGCTGCTTTTGACCCAACAATCC
TATTATACAATGCTGTTTCCAATATAATCTGTCAAATGGT
GTTTGGCCAGAGATTTGACTATGCTGACCACCAGTTCAAA
ACAATGTTAAAATATATTTCTAAAAGCATTCAACTAGAAG
GATCCGTTTGGGGACAGATCTATGAAGCATTTCCAGCCAT
TATGAAGCATCTTCCAGGGCCTCACAATGATATTTTCAGT
AACTATGACTTACTGAAGAGCTTCGTACATGAGGTCATTG
TAAAACACAAGGCTAAACTGGATCCCTCAGAGCCTCGTGA
CTACATCGATACCTTCCTAATCGAGATGAAGGAGAAACCC
CATGAAAGAGTAAACGGCTTTGAGGAACCAAACCTTGTTG
CATGTGTTCTTGACCTGTTTCTGGCCGGAACTGAATCCAC
ATCCAATACATTATGTTGGGGGCTCATATACCTCATAATG
TATCCAGACGTACAAGAAAAGGTCCAGGAGGAGATCGACA
GAGTGATTGGAAACTCAAGAGAGCCAAGTATAGCCGACAA
ACCCAACATGCCCTACACAGAGGCTGTCATCCATGAGATC
ATGAGATTTGGAGATGTTATACCATTGAATGGATTGCGAG
TGGCTGCAAGAGACACAACCCTTGGAGAATGCTTCATCCC
AAAGGGCACAACCGTTTTACCTATACTGCACTCTGTTCTC
TTTGATGAAAACGAATGGGAGACACCCTACAAGTTCAATC
CTGGCCACTTTTTAGACAAAGAGGGCAAGTTTGTAAGGCG
AGATGCATTTATGCCCTTTTCTGCAGGAAAGAGGGTCTGT
TTGGGGGAGCAGATCGCCAGAATTGAACTCTTCCTATTTT
TTGTCAGTTTGTTCCGCAAATTCAGATTTTCAGCCACAGA
GGGAGAGAAACTCAACATGGATGGAGTGATTGGAATAACA
CGCACTCCACACCCGTTCAAGATCTGTGCAACAGCACGTT
GAGACAAATCTGACTATTTTTATTAGGAATTAATGAACAA
TATTTATAGTCAATTACAGTACATTATATGTATCTAACAT
GACACTACTGGCAATTTTTATTTCACATTTTGGGCTTTTT
GACTTCATAAATTGTTTTTCTTTTCCTGGCTTTATTGAAA
ATAAACACCTAAAAAAGTGTTTCTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations