Transcript

pisd-202

ID
ZDB-TSCRIPT-090929-5999
Name
pisd-202
Previous Names
  • pisd-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022693 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022693|OTTDARG00000018658|ZDB-GENE-061215-46 pisd|OTTDARP00000018976 CH211-202F5.4-002 LG_ BX510338.7 Danio rerio protein_coding KNOWN, 857 bp
AAACCTTTGAGAAGAACGACAGACCTCCTATTGTGTAACT
CGGTCTAAAGATTTCCAATCATTAGGCCGTGAATTCAGCA
GAGGCTTGAAGGAGGAGGTGGACCCATTTACCAGCCCGCC
AATCACAGCTCTGCATCCCACTGGCAACGAGCAAAGAGGG
GACGGTCTTTAAGCTTTGCAGCGGAGTACCACGGGGCCAA
ACGAACAGAGGGAGCACGAGAGAGAGGGCTAAAGCCTGCG
ATACACAATAATCCCTCCACAGTGATCATGTGTCAGCGGA
GCCTAAAGCAGCAGCAGAAGGGGCCGGTGCGGAGTGCTGC
GGGGAAATGTTTCCCCAGCTGGCCCTACGGCGGCGTCTAG
GCCAGTTGAGCTGCATGTCCCGGCCTACTGCTCGCCTTCG
CTCATGGCCTCTGTCCTTCCTCTACTACATCCTGCCCTTC
GGAGCTCTTAAACCTCTCGCCAAAGTAGGCTGGAGGCCCA
CAAGCAGAGTTACAATCTACAAGACTATACCAACACGACT
GCTGTCCAGAGCCTGGGGGCGCTTGAACCGGGTGGACTTG
CCCAATTGGTTGAGGAAACCTATCTACAATTTGTATATAT
GGACATTTGGAGTCAACATGAAAGAAGCGGCTGTGGAGGA
TCTACAGCACTATAGAAACCTGGGCGAGTTTTTTAGGCGC
AAACTCAAGCCTCAGGTTCGGCCAGTTTGCGACTCGCATT
GTGTGATCAGTCCAGCTGATGGAAAGATCCTTCATTTCGG
TCGTGTGAAGAACTGTGAGGTGGAGCAGGTGAAAGGAGTC
ACCTACTCTCTGGAAACCTTCCTCGGCCCACGCACTTGGT
CTGAGAGTTTAACAGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations