Transcript

cyp2ad2-002

ID
ZDB-TSCRIPT-090929-598
Name
cyp2ad2-002
Previous Names
  • cyp2j28-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000005995 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000005995|OTTDARG00000005530|ZDB-GENE-020812-2 cyp2ad2|no_translation cyp2ad2-002 LG_ BX322665.5 Danio rerio protein_coding KNOWN, 500 bp
GAGGACTGGGACCCTGCAAACCCACGTGACTTTATCGACA
ACTACCTGACTGAGATGGAAAAGAAAAAGAGTGACCCTCA
AGCTGGCTTTAACATAGAAAGTTTAATCATTTCTTGCCTA
GACATAGTTGAGGCTGGGACAGAGACGGGTGCGACTACAT
TACGCTGGGGTCTGCTTTTTATGATCAAGTTCCCAGAAAT
ACAGAAAAAAGTCCAGGCAGAGATAGACAGAGTGATTGGA
CAGTCACGTCAACCCTGCTTGGATGACAGAGTTAATATGC
CCTATACTGAAGCTGTTTTACATGAGATTCAAAGATTTGG
GGATGTTGTTCCACTTGGATTCCCCAAACAAGCAGCTGTA
GACACAAAAATTGGGAACTACTTCATTCCAAAGTCTGAAC
AAATCCAGTAGATTTCATTCTCTCTTTATTAGGGGACTTC
TATTACAACAAACCTGTCTTCGGTCCTGCATGATCCAAAC
GAATGGGAAACCCCAGACAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations