Transcript

slc25a35-201

ID
ZDB-TSCRIPT-090929-5958
Name
slc25a35-201
Previous Names
  • slc25a35-001
  • si:ch211-268m12.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022649 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022649|OTTDARG00000018627|ZDB-GENE-060526-142 slc25a35|OTTDARP00000018941 CH211-268M12.5-001 LG_ BX276102.11 Danio rerio protein_coding NOVEL, 955 bp
ATGGATTTCATTCTCGGTGGCGTCGCTGCGTGTGGTGCCT
GCTTCTTTACAAACCCTCTGGAGGTTGTGAAAACTAGAAT
GCAATTGCAAGGAGAGCTGAAAAGTCGAGGAACATACCAA
GTGTATTACAGGAATGTATTTCATGCCTTTTACACGATAG
GCAAAATAGATGGACTGGCTGGTCTGCAGAAAGGTTTGGT
TCCCGGATTGGTTTATCAATTTTTTATGAATGGGGTCCGG
CTTGGTTCGTACGCCCTCACCGAGTCCTTGGGCTACATTC
ACACGGACGGAAGGGTTAGCGCTACGAAGAGCACAGTGTC
TGGGGCCATTGCTGGTGTTGTGGGCGCTGTAATGGGCAGC
CCGATTTACCTAGTAAAAACACATCTTCAAAGTCAGTCCA
CTTCCTCTATTGCAGTTGGACACCAGTATAAGCACAGGGG
AATGACAAATGCTCTATTTGCCATTCACAAACAGCATGGA
ATTTTGGGCTTGTGGAGGGGAGCAAGTGCAGCGATCCCAA
GGGTTAGTGTGGGATCAGCTGCTCAACTCGCTACTTTCTC
TGCCTCTAAAGAGATGGTCAATGACTTGCAGGTGTTCTCT
GAGGGCAGCTGGTTAATTGCTCTCAGTGCCGGTATGATTA
GTAGTGTAGTGGTTGTACTAGCTATGACTCCTTTTGATGT
GGTCAGTACTCGACTCTACAACCAGCCTGTGGACCATCTT
GGCAAGGGAATGTTGTACAGAGGTTTTGTGGACTGTTTCT
CTAAGACACTGAAGAAGGAAGGTATGACTGGTTTGTATAA
AGGCCTTGGAGCATCCTACTTCCGCCTCGGACCTCATACC
ATCCTTTCTCTGCTTTTCTGGAACGAGCTTCGCTGTTTGC
ACCAAAGCTACAGCTAGAATTTCCCTATTGACTACATCAG
TAAAATATCAACTTTAACTTTAACTTACTGATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations